Incidental Mutation 'R1661:Smc3'
ID186801
Institutional Source Beutler Lab
Gene Symbol Smc3
Ensembl Gene ENSMUSG00000024974
Gene Namestructural maintenance of chromosomes 3
SynonymsSmcD, Mmip1, Bamacan, Cspg6
MMRRC Submission 039697-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1661 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location53600398-53645833 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53625065 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 403 (D403G)
Ref Sequence ENSEMBL: ENSMUSP00000025930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025930]
PDB Structure
SMC hinge heterodimer (Mouse) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025930
AA Change: D403G

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000025930
Gene: ENSMUSG00000024974
AA Change: D403G

DomainStartEndE-ValueType
Pfam:AAA_23 5 359 5.4e-10 PFAM
SMC_hinge 530 643 1.85e-23 SMART
low complexity region 684 711 N/A INTRINSIC
Blast:SMC_hinge 712 804 3e-49 BLAST
low complexity region 805 818 N/A INTRINSIC
Blast:SMC_hinge 819 870 3e-23 BLAST
Blast:INB 898 1174 2e-52 BLAST
PDB:1XEW|Y 1032 1212 6e-30 PDB
SCOP:d1e69a_ 1114 1193 2e-9 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the SMC3 subfamily of SMC proteins. The encoded protein occurs in certain cell types as either an intracellular, nuclear protein or a secreted protein. The nuclear form, known as structural maintenance of chromosomes 3, is a component of the multimeric cohesin complex that holds together sister chromatids during mitosis, enabling proper chromosome segregation. Post-translational modification of the encoded protein by the addition of chondroitin sulfate chains gives rise to the secreted proteoglycan bamacan, an abundant basement membrane protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality. Mice heterozygous for this allele exhibit partial postnatal lethality, decreased body weight, abnormal craniofacial morphology, and increased T cell number. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G A 17: 24,377,842 G423E probably damaging Het
Acox3 A T 5: 35,603,027 H429L probably damaging Het
Adamts9 G T 6: 92,880,623 Q895K possibly damaging Het
Amotl2 T A 9: 102,730,096 I701N probably damaging Het
Angel2 T C 1: 190,937,467 Y115H probably damaging Het
Appbp2 T C 11: 85,210,110 probably null Het
Arhgap33 A C 7: 30,532,323 C113W probably damaging Het
Asprv1 A G 6: 86,628,736 N188S probably damaging Het
Atp8a2 T C 14: 59,860,186 I798V possibly damaging Het
Caml C A 13: 55,631,971 L286I probably benign Het
Ccdc125 A G 13: 100,693,573 I284V probably benign Het
Cep89 A G 7: 35,417,680 T236A possibly damaging Het
Cfap61 T C 2: 146,035,319 probably null Het
Cog2 T C 8: 124,542,890 F390L probably benign Het
Creg2 C T 1: 39,623,204 W253* probably null Het
Cttnbp2 A T 6: 18,434,983 I292K probably benign Het
Ddb1 A T 19: 10,629,080 Y1114F probably benign Het
Dnah6 T C 6: 73,124,778 E1921G probably benign Het
Dync1h1 T C 12: 110,656,357 F3494L probably damaging Het
F7 A G 8: 13,035,209 I412V probably benign Het
Fam208b C T 13: 3,573,860 S2030N possibly damaging Het
Fam222b A G 11: 78,155,161 Y388C probably damaging Het
Fam227a G A 15: 79,620,677 probably null Het
Fam71f2 G C 6: 29,285,938 R132P probably damaging Het
Fbxo32 A C 15: 58,191,469 V156G probably damaging Het
Fem1b C T 9: 62,797,274 V235I probably damaging Het
Fnip2 A G 3: 79,515,149 F108S probably benign Het
Fras1 A T 5: 96,598,909 S613C probably damaging Het
Gm7276 C A 18: 77,185,570 probably benign Het
Gm996 T C 2: 25,579,155 D248G possibly damaging Het
Gnb4 A C 3: 32,590,039 L152* probably null Het
Hsd17b4 G A 18: 50,160,215 E274K probably benign Het
Htr4 T C 18: 62,412,234 I30T probably damaging Het
Ighmbp2 A G 19: 3,267,246 L542P probably damaging Het
Ikzf2 T A 1: 69,538,814 Y512F probably damaging Het
Itpr1 A G 6: 108,482,897 N2051D probably benign Het
Kif1c C T 11: 70,728,397 L953F probably damaging Het
Klhl22 C A 16: 17,776,488 D160E probably benign Het
Kpna6 T A 4: 129,657,471 R80S probably benign Het
Lclat1 A G 17: 73,188,004 E142G probably damaging Het
Lrig3 T C 10: 125,997,701 Y349H probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Map1b T A 13: 99,431,929 N1428I unknown Het
Map3k19 T A 1: 127,817,656 T1354S possibly damaging Het
Med13l T A 5: 118,749,748 W1696R probably damaging Het
Megf8 A G 7: 25,363,847 T2543A probably damaging Het
Mfn1 T G 3: 32,534,322 V66G probably benign Het
Muc15 C T 2: 110,733,898 Q260* probably null Het
Nfkb1 T C 3: 135,594,957 H616R probably damaging Het
Nnmt A G 9: 48,604,874 S29P probably benign Het
Nrde2 A T 12: 100,149,860 S122T probably benign Het
Olfr1279 T C 2: 111,306,771 C189R probably damaging Het
Olfr714 T C 7: 107,074,274 S149P probably damaging Het
Olfr853 C T 9: 19,537,328 V201I probably benign Het
Pced1b A G 15: 97,384,713 H211R probably benign Het
Pcsk5 A T 19: 17,447,574 S1622T probably damaging Het
Pde10a A G 17: 8,898,870 D26G probably damaging Het
Phf11a A T 14: 59,280,788 L170H probably damaging Het
Ppil6 A G 10: 41,514,180 D307G probably benign Het
Ppp6r2 A G 15: 89,253,051 D6G possibly damaging Het
Psmd12 A T 11: 107,491,906 K212N probably damaging Het
Rc3h1 T A 1: 160,959,423 V796E probably benign Het
Rgl1 T C 1: 152,533,575 Y503C probably damaging Het
Ryr1 A T 7: 29,101,738 I860N probably damaging Het
Saal1 A T 7: 46,692,800 N406K possibly damaging Het
Sh3pxd2a A T 19: 47,278,320 Y277N probably damaging Het
Slitrk1 A T 14: 108,911,927 Y451N probably damaging Het
Smad1 T C 8: 79,372,029 E52G probably damaging Het
Smarcd1 A T 15: 99,707,638 probably null Het
Srd5a2 A T 17: 74,021,481 W201R probably damaging Het
Syt2 C A 1: 134,747,620 A403D probably damaging Het
Tax1bp1 T A 6: 52,736,912 S225R probably benign Het
Thap3 C T 4: 151,985,704 V78M probably damaging Het
Thoc5 A G 11: 4,919,792 K446R probably benign Het
Timmdc1 A C 16: 38,510,717 probably null Het
Tmem126b G T 7: 90,475,971 A2E probably damaging Het
Trim9 T A 12: 70,255,113 R584W probably damaging Het
Vmn1r25 A T 6: 57,978,461 I281N probably damaging Het
Wdr59 A G 8: 111,479,362 F553S probably damaging Het
Wnt5a T C 14: 28,518,343 M150T probably benign Het
Zfp53 A G 17: 21,509,504 T600A probably damaging Het
Other mutations in Smc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Smc3 APN 19 53629327 missense probably damaging 0.99
IGL01300:Smc3 APN 19 53641852 splice site probably benign
IGL02136:Smc3 APN 19 53635716 missense probably benign 0.02
IGL02216:Smc3 APN 19 53621844 missense probably damaging 1.00
IGL02473:Smc3 APN 19 53636448 missense probably benign 0.06
IGL02797:Smc3 APN 19 53638758 missense probably benign 0.03
IGL02959:Smc3 APN 19 53623557 missense probably benign 0.00
IGL03343:Smc3 APN 19 53613842 missense probably damaging 1.00
Bits UTSW 19 53623218 critical splice donor site probably null
Pieces UTSW 19 53629371 missense probably damaging 0.99
Smithereens UTSW 19 53641931 missense probably damaging 1.00
R0081:Smc3 UTSW 19 53601562 splice site probably benign
R0940:Smc3 UTSW 19 53640909 missense probably benign 0.10
R1248:Smc3 UTSW 19 53634078 missense probably benign 0.01
R1779:Smc3 UTSW 19 53639369 missense probably benign 0.02
R2046:Smc3 UTSW 19 53639414 missense probably benign 0.00
R2073:Smc3 UTSW 19 53631533 missense probably benign 0.08
R2074:Smc3 UTSW 19 53631533 missense probably benign 0.08
R3077:Smc3 UTSW 19 53627891 missense probably benign 0.16
R4962:Smc3 UTSW 19 53631517 missense probably damaging 0.99
R5684:Smc3 UTSW 19 53640804 missense probably benign 0.00
R6020:Smc3 UTSW 19 53625163 critical splice donor site probably null
R6169:Smc3 UTSW 19 53634086 missense probably benign 0.02
R6221:Smc3 UTSW 19 53641931 missense probably damaging 1.00
R6258:Smc3 UTSW 19 53627731 splice site probably null
R6960:Smc3 UTSW 19 53629371 missense probably damaging 0.99
R7048:Smc3 UTSW 19 53629251 missense probably benign 0.01
R7148:Smc3 UTSW 19 53641895 missense possibly damaging 0.93
R7157:Smc3 UTSW 19 53641898 missense probably damaging 1.00
R7805:Smc3 UTSW 19 53640959 missense probably benign 0.26
R7968:Smc3 UTSW 19 53623218 critical splice donor site probably null
R8066:Smc3 UTSW 19 53615145 missense probably damaging 1.00
R8202:Smc3 UTSW 19 53628692 missense possibly damaging 0.94
R8472:Smc3 UTSW 19 53628711 missense probably benign 0.02
X0026:Smc3 UTSW 19 53625120 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CTCAATAACCTATAGTCCCCACGCAATG -3'
(R):5'- GCCTTTCTAACTGAGCGGCTTCTTT -3'

Sequencing Primer
(F):5'- GGCTCAAGCTACACAGGAAAGA -3'
(R):5'- acagtgaattacagaaacagcc -3'
Posted On2014-05-09