Incidental Mutation 'R1662:Mroh2a'
Institutional Source Beutler Lab
Gene Symbol Mroh2a
Ensembl Gene ENSMUSG00000079429
Gene Namemaestro heat-like repeat family member 2A
SynonymsHeatr7b1, ENSMUSG00000044873, OTTMUSG00000020804
MMRRC Submission 039698-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.943) question?
Stock #R1662 (G1)
Quality Score94
Status Not validated
Chromosomal Location88226986-88262289 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 88241618 bp
Amino Acid Change Isoleucine to Leucine at position 672 (I672L)
Ref Sequence ENSEMBL: ENSMUSP00000130508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061013] [ENSMUST00000113130]
Predicted Effect probably benign
Transcript: ENSMUST00000061013
AA Change: I672L

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429
AA Change: I672L

low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1235 1248 N/A INTRINSIC
SCOP:d1jdha_ 1371 1669 9e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113130
AA Change: I669L

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429
AA Change: I669L

low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1232 1245 N/A INTRINSIC
SCOP:d1gw5a_ 1446 1671 6e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142632
Meta Mutation Damage Score 0.0778 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a HEAT-domain-containing protein. The function of the encoded protein has not been characterized. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730409E04Rik T A 4: 126,611,682 M1K probably null Het
5730507C01Rik A C 12: 18,531,966 R119S possibly damaging Het
Abca1 T A 4: 53,090,251 probably null Het
Aff1 G A 5: 103,841,057 G830D probably damaging Het
AI987944 T C 7: 41,374,449 T369A possibly damaging Het
Aoah A G 13: 21,000,113 probably null Het
Arhgap40 C G 2: 158,539,270 C349W probably damaging Het
Atic T A 1: 71,576,127 D438E probably benign Het
Barhl2 A T 5: 106,453,499 M338K probably benign Het
Btd T C 14: 31,666,790 V156A probably damaging Het
Ccdc82 T C 9: 13,262,772 V319A probably damaging Het
Celsr1 G T 15: 86,031,062 N903K probably damaging Het
Cenpf T A 1: 189,657,771 N1288I probably damaging Het
Ciao1 G A 2: 127,244,937 T252I probably benign Het
Cma2 T C 14: 55,973,116 C87R probably damaging Het
Cops7a T A 6: 124,962,438 R83W probably damaging Het
Cxcr6 A T 9: 123,810,548 M205L possibly damaging Het
Dcc A G 18: 71,420,338 L749P probably benign Het
Dync1i2 C T 2: 71,250,979 T484I possibly damaging Het
Epas1 A T 17: 86,829,027 K742N probably damaging Het
Evc2 A G 5: 37,348,750 T138A probably benign Het
F5 T C 1: 164,207,888 I1877T probably damaging Het
Fat1 T G 8: 44,953,164 V984G probably benign Het
Fat4 T A 3: 38,980,779 V2860D probably damaging Het
Foxn4 C T 5: 114,256,894 R324Q probably benign Het
Gapdhs C T 7: 30,737,002 R120H probably damaging Het
Gcnt3 T C 9: 70,034,377 D303G probably benign Het
Gm16432 A G 1: 178,046,986 K140E unknown Het
Gng11 A T 6: 4,008,066 Y43F probably benign Het
Hectd4 A C 5: 121,317,245 M651L probably benign Het
Ifngr2 T A 16: 91,560,596 Y200N probably benign Het
Iqgap3 T C 3: 88,098,401 V512A probably benign Het
Kdm2a A C 19: 4,328,212 D187E probably damaging Het
Klhl8 A G 5: 103,872,045 V370A probably damaging Het
Kmt2a G A 9: 44,836,670 probably benign Het
Krt12 C A 11: 99,420,824 V184F probably benign Het
Lrrc8c A T 5: 105,606,757 I133F probably benign Het
Map1a C G 2: 121,306,408 S2568R possibly damaging Het
Mbnl1 C A 3: 60,625,172 Q301K probably damaging Het
Med12l A T 3: 59,093,617 K724N probably damaging Het
Mybph C T 1: 134,193,636 P45S probably benign Het
Myo15 T A 11: 60,501,701 S2157T probably damaging Het
Olfr113 G T 17: 37,575,273 T50K probably damaging Het
Olfr193 T C 16: 59,110,604 E2G probably benign Het
Olfr374 T C 8: 72,109,779 V71A probably benign Het
Olfr721-ps1 T A 14: 14,407,880 Y217* probably null Het
Otogl A G 10: 107,798,357 I1419T possibly damaging Het
Ovol1 A T 19: 5,551,639 F118L probably damaging Het
Pak7 T C 2: 136,116,760 D136G probably damaging Het
Pik3r2 T C 8: 70,770,606 Y417C probably damaging Het
Ppp2r2a T C 14: 67,016,603 N372S probably benign Het
Prss30 G T 17: 23,972,832 N238K possibly damaging Het
Prss33 C A 17: 23,834,811 probably null Het
Ptpn4 T C 1: 119,765,058 E187G probably damaging Het
Ptprg A T 14: 12,207,357 N100I probably damaging Het
Rbpms2 T C 9: 65,651,042 V130A probably benign Het
Rdh7 A T 10: 127,888,612 M1K probably null Het
Rtp3 A C 9: 110,986,683 S205A probably benign Het
Ryr3 G T 2: 112,709,273 D3207E probably damaging Het
Scn9a T A 2: 66,483,459 T1972S probably benign Het
Scnn1b T C 7: 121,902,328 V122A probably benign Het
Slc15a4 A G 5: 127,608,979 L213S probably damaging Het
Slc27a5 T A 7: 12,991,246 I425F probably damaging Het
Spata31d1b A G 13: 59,716,628 D530G probably benign Het
Tcf25 T A 8: 123,381,550 S115T probably benign Het
Tet2 A G 3: 133,466,852 L1883P possibly damaging Het
Trim21 T A 7: 102,561,898 R205* probably null Het
Ttc23 G T 7: 67,725,321 probably null Het
Unc13d T C 11: 116,068,673 K658R probably null Het
Vmn1r43 A G 6: 89,869,590 F305L possibly damaging Het
Vmn2r2 A T 3: 64,117,130 C677S probably benign Het
Wnt5a T C 14: 28,518,343 M150T probably benign Het
Ythdc1 G A 5: 86,828,122 probably null Het
Zcchc6 T C 13: 59,799,903 E466G possibly damaging Het
Zdbf2 A T 1: 63,304,249 R596* probably null Het
Other mutations in Mroh2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Mroh2a APN 1 88230746 missense probably damaging 0.99
IGL00990:Mroh2a APN 1 88244970 missense probably benign 0.03
IGL00990:Mroh2a APN 1 88234120 missense possibly damaging 0.76
IGL03097:Mroh2a UTSW 1 88235376 missense probably benign 0.30
R0032:Mroh2a UTSW 1 88256166 frame shift probably null
R0068:Mroh2a UTSW 1 88256166 frame shift probably null
R0139:Mroh2a UTSW 1 88257802 missense probably damaging 1.00
R0197:Mroh2a UTSW 1 88246042 missense probably damaging 1.00
R0242:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0322:Mroh2a UTSW 1 88230680 nonsense probably null
R0374:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0387:Mroh2a UTSW 1 88246042 missense probably damaging 1.00
R0412:Mroh2a UTSW 1 88235216 missense probably benign 0.01
R0536:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R0548:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0580:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R0581:Mroh2a UTSW 1 88256166 frame shift probably null
R0583:Mroh2a UTSW 1 88256166 frame shift probably null
R0613:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R0652:Mroh2a UTSW 1 88230680 nonsense probably null
R0657:Mroh2a UTSW 1 88255565 missense probably damaging 1.00
R0659:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0659:Mroh2a UTSW 1 88250342 missense probably damaging 1.00
R0671:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0675:Mroh2a UTSW 1 88228380 missense probably damaging 0.99
R0675:Mroh2a UTSW 1 88250342 missense probably damaging 1.00
R0689:Mroh2a UTSW 1 88230680 nonsense probably null
R0689:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R0735:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R0761:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R0766:Mroh2a UTSW 1 88230680 nonsense probably null
R0845:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R0853:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R0959:Mroh2a UTSW 1 88232257 frame shift probably null
R0960:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R1004:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R1013:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R1028:Mroh2a UTSW 1 88235376 missense probably benign 0.30
R1268:Mroh2a UTSW 1 88230680 nonsense probably null
R1281:Mroh2a UTSW 1 88256167 frame shift probably null
R1414:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R1439:Mroh2a UTSW 1 88257802 missense probably damaging 1.00
R1441:Mroh2a UTSW 1 88241631 missense possibly damaging 0.93
R1442:Mroh2a UTSW 1 88232353 splice site probably benign
R1442:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R1465:Mroh2a UTSW 1 88257802 missense probably damaging 1.00
R1686:Mroh2a UTSW 1 88230680 nonsense probably null
R1686:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R1780:Mroh2a UTSW 1 88230680 nonsense probably null
R1846:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R1899:Mroh2a UTSW 1 88235376 missense probably benign 0.30
R1958:Mroh2a UTSW 1 88237491 nonsense probably null
R2122:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R2248:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R2306:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R2869:Mroh2a UTSW 1 88232257 frame shift probably null
R2870:Mroh2a UTSW 1 88232257 frame shift probably null
R2871:Mroh2a UTSW 1 88255565 missense probably damaging 1.00
R2872:Mroh2a UTSW 1 88232257 frame shift probably null
R3408:Mroh2a UTSW 1 88232257 frame shift probably null
R3608:Mroh2a UTSW 1 88244995 missense probably damaging 1.00
R3730:Mroh2a UTSW 1 88232257 frame shift probably null
R3937:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4022:Mroh2a UTSW 1 88246042 missense probably damaging 1.00
R4049:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4133:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R4361:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R4392:Mroh2a UTSW 1 88259589 missense probably damaging 1.00
R4401:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R4402:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R4575:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4625:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R4631:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4665:Mroh2a UTSW 1 88241618 missense probably benign 0.07
R4701:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R4701:Mroh2a UTSW 1 88241618 missense probably benign 0.07
R4771:Mroh2a UTSW 1 88251365 missense probably damaging 1.00
R4795:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4839:Mroh2a UTSW 1 88237944 missense probably damaging 1.00
R4873:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R4875:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R4896:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R5007:Mroh2a UTSW 1 88232257 frame shift probably null
R5031:Mroh2a UTSW 1 88232257 frame shift probably null
R5062:Mroh2a UTSW 1 88232257 frame shift probably null
R5301:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5367:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R5371:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5446:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R5484:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5506:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5561:Mroh2a UTSW 1 88232257 frame shift probably null
R5615:Mroh2a UTSW 1 88232257 frame shift probably null
R5825:Mroh2a UTSW 1 88230680 nonsense probably null
R5891:Mroh2a UTSW 1 88241615 missense possibly damaging 0.93
R5906:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5928:Mroh2a UTSW 1 88241618 missense probably benign 0.07
R6004:Mroh2a UTSW 1 88248655 missense probably damaging 1.00
R6035:Mroh2a UTSW 1 88230668 missense probably damaging 1.00
R6064:Mroh2a UTSW 1 88232257 frame shift probably null
R6074:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R6091:Mroh2a UTSW 1 88232257 frame shift probably null
R6127:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R6234:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R6234:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R6244:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R6464:Mroh2a UTSW 1 88257802 missense probably damaging 1.00
R6465:Mroh2a UTSW 1 88232257 frame shift probably null
R6575:Mroh2a UTSW 1 88232257 frame shift probably null
R6809:Mroh2a UTSW 1 88235216 missense probably benign 0.01
R6819:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R6854:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R6860:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R7126:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R7818:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R8350:Mroh2a UTSW 1 88244083 splice site probably null
RF024:Mroh2a UTSW 1 88242485 missense probably damaging 1.00
V5622:Mroh2a UTSW 1 88227091 start gained probably benign
V8831:Mroh2a UTSW 1 88256167 frame shift probably null
X0027:Mroh2a UTSW 1 88248613 missense possibly damaging 0.86
X0028:Mroh2a UTSW 1 88232257 frame shift probably null
X0028:Mroh2a UTSW 1 88256166 frame shift probably null
X0033:Mroh2a UTSW 1 88256166 frame shift probably null
X0034:Mroh2a UTSW 1 88232257 frame shift probably null
X0034:Mroh2a UTSW 1 88232292 missense probably damaging 1.00
X0034:Mroh2a UTSW 1 88256166 frame shift probably null
X0039:Mroh2a UTSW 1 88232257 frame shift probably null
X0057:Mroh2a UTSW 1 88232257 frame shift probably null
X0057:Mroh2a UTSW 1 88255655 missense probably benign 0.25
X0057:Mroh2a UTSW 1 88256166 frame shift probably null
X0063:Mroh2a UTSW 1 88232257 frame shift probably null
Z1188:Mroh2a UTSW 1 88235216 missense probably benign 0.01
Z1190:Mroh2a UTSW 1 88232257 frame shift probably null
Z1192:Mroh2a UTSW 1 88235216 missense probably benign 0.01
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ccatctcaactctatccatcaacc -3'
Posted On2014-05-09