Incidental Mutation 'R1662:Ryr3'
ID186814
Institutional Source Beutler Lab
Gene Symbol Ryr3
Ensembl Gene ENSMUSG00000057378
Gene Nameryanodine receptor 3
Synonymscalcium release channel isoform 3
MMRRC Submission 039698-MU
Accession Numbers

Genbank: NM_177652.2

Is this an essential gene? Possibly non essential (E-score: 0.439) question?
Stock #R1662 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location112631355-113217096 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 112709273 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 3207 (D3207E)
Ref Sequence ENSEMBL: ENSMUSP00000147250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080673] [ENSMUST00000091818] [ENSMUST00000134358] [ENSMUST00000208151] [ENSMUST00000208290]
Predicted Effect probably benign
Transcript: ENSMUST00000080673
AA Change: D3207E

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000079503
Gene: ENSMUSG00000057378
AA Change: D3207E

DomainStartEndE-ValueType
low complexity region 90 99 N/A INTRINSIC
MIR 100 155 3.27e-4 SMART
MIR 162 207 7.52e-4 SMART
MIR 215 269 8.06e-4 SMART
MIR 275 368 8.4e-25 SMART
Pfam:RYDR_ITPR 438 642 1.1e-71 PFAM
SPRY 657 795 1.16e-24 SMART
Pfam:RyR 848 942 1.5e-34 PFAM
Pfam:RyR 962 1056 1.2e-32 PFAM
SPRY 1084 1207 7.99e-37 SMART
SPRY 1325 1465 6.25e-30 SMART
low complexity region 1757 1772 N/A INTRINSIC
low complexity region 1773 1788 N/A INTRINSIC
low complexity region 1932 1957 N/A INTRINSIC
Pfam:RYDR_ITPR 2018 2228 1.8e-59 PFAM
Pfam:RyR 2595 2689 1.2e-36 PFAM
Pfam:RyR 2713 2801 2.1e-31 PFAM
low complexity region 2877 2887 N/A INTRINSIC
low complexity region 3169 3184 N/A INTRINSIC
low complexity region 3327 3338 N/A INTRINSIC
PDB:2BCX|B 3462 3491 9e-12 PDB
low complexity region 3532 3540 N/A INTRINSIC
coiled coil region 3585 3614 N/A INTRINSIC
Pfam:RIH_assoc 3715 3848 4.9e-40 PFAM
low complexity region 3855 3875 N/A INTRINSIC
SCOP:d1sra__ 3893 3989 1e-10 SMART
low complexity region 4096 4134 N/A INTRINSIC
transmembrane domain 4178 4200 N/A INTRINSIC
Pfam:RR_TM4-6 4227 4497 4.7e-96 PFAM
Pfam:Ion_trans 4599 4762 2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091818
AA Change: D3227E

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000089426
Gene: ENSMUSG00000057378
AA Change: D3227E

DomainStartEndE-ValueType
low complexity region 110 119 N/A INTRINSIC
MIR 120 175 3.27e-4 SMART
MIR 182 227 7.52e-4 SMART
MIR 235 289 8.06e-4 SMART
MIR 295 388 8.4e-25 SMART
Pfam:RYDR_ITPR 460 655 1.2e-64 PFAM
SPRY 677 815 1.16e-24 SMART
Pfam:RyR 869 959 3.3e-38 PFAM
Pfam:RyR 983 1073 2.5e-32 PFAM
SPRY 1104 1227 7.99e-37 SMART
SPRY 1345 1485 6.25e-30 SMART
low complexity region 1777 1792 N/A INTRINSIC
low complexity region 1793 1808 N/A INTRINSIC
low complexity region 1952 1977 N/A INTRINSIC
Pfam:RYDR_ITPR 2040 2248 5.8e-67 PFAM
Pfam:RyR 2616 2706 6.3e-33 PFAM
Pfam:RyR 2734 2818 6.6e-26 PFAM
low complexity region 2897 2907 N/A INTRINSIC
low complexity region 3189 3204 N/A INTRINSIC
PDB:2BCX|B 3487 3516 1e-11 PDB
low complexity region 3557 3565 N/A INTRINSIC
coiled coil region 3610 3639 N/A INTRINSIC
Pfam:RIH_assoc 3744 3862 3.5e-34 PFAM
low complexity region 3880 3900 N/A INTRINSIC
SCOP:d1sra__ 3918 4014 1e-10 SMART
low complexity region 4121 4159 N/A INTRINSIC
transmembrane domain 4203 4225 N/A INTRINSIC
Pfam:RR_TM4-6 4252 4522 1.1e-98 PFAM
Pfam:Ion_trans 4625 4799 6.2e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000134358
AA Change: D3207E

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000208151
AA Change: D3207E

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably damaging
Transcript: ENSMUST00000208290
AA Change: D3207E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ryanodine receptor, which functions to release calcium from intracellular storage for use in many cellular processes. For example, the encoded protein is involved in skeletal muscle contraction by releasing calcium from the sarcoplasmic reticulum followed by depolarization of T-tubules. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired muscle contraction at an early age, changes in hippocampal synaptic plasticity, increased locomotor activity with a tendency to circle, and impaired relearning of a spatial task. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(5) Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730409E04Rik T A 4: 126,611,682 M1K probably null Het
5730507C01Rik A C 12: 18,531,966 R119S possibly damaging Het
Abca1 T A 4: 53,090,251 probably null Het
Aff1 G A 5: 103,841,057 G830D probably damaging Het
AI987944 T C 7: 41,374,449 T369A possibly damaging Het
Aoah A G 13: 21,000,113 probably null Het
Arhgap40 C G 2: 158,539,270 C349W probably damaging Het
Atic T A 1: 71,576,127 D438E probably benign Het
Barhl2 A T 5: 106,453,499 M338K probably benign Het
Btd T C 14: 31,666,790 V156A probably damaging Het
Ccdc82 T C 9: 13,262,772 V319A probably damaging Het
Celsr1 G T 15: 86,031,062 N903K probably damaging Het
Cenpf T A 1: 189,657,771 N1288I probably damaging Het
Ciao1 G A 2: 127,244,937 T252I probably benign Het
Cma2 T C 14: 55,973,116 C87R probably damaging Het
Cops7a T A 6: 124,962,438 R83W probably damaging Het
Cxcr6 A T 9: 123,810,548 M205L possibly damaging Het
Dcc A G 18: 71,420,338 L749P probably benign Het
Dync1i2 C T 2: 71,250,979 T484I possibly damaging Het
Epas1 A T 17: 86,829,027 K742N probably damaging Het
Evc2 A G 5: 37,348,750 T138A probably benign Het
F5 T C 1: 164,207,888 I1877T probably damaging Het
Fat1 T G 8: 44,953,164 V984G probably benign Het
Fat4 T A 3: 38,980,779 V2860D probably damaging Het
Foxn4 C T 5: 114,256,894 R324Q probably benign Het
Gapdhs C T 7: 30,737,002 R120H probably damaging Het
Gcnt3 T C 9: 70,034,377 D303G probably benign Het
Gm16432 A G 1: 178,046,986 K140E unknown Het
Gng11 A T 6: 4,008,066 Y43F probably benign Het
Hectd4 A C 5: 121,317,245 M651L probably benign Het
Ifngr2 T A 16: 91,560,596 Y200N probably benign Het
Iqgap3 T C 3: 88,098,401 V512A probably benign Het
Kdm2a A C 19: 4,328,212 D187E probably damaging Het
Klhl8 A G 5: 103,872,045 V370A probably damaging Het
Kmt2a G A 9: 44,836,670 probably benign Het
Krt12 C A 11: 99,420,824 V184F probably benign Het
Lrrc8c A T 5: 105,606,757 I133F probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Map1a C G 2: 121,306,408 S2568R possibly damaging Het
Mbnl1 C A 3: 60,625,172 Q301K probably damaging Het
Med12l A T 3: 59,093,617 K724N probably damaging Het
Mroh2a A C 1: 88,241,618 I672L probably benign Het
Mybph C T 1: 134,193,636 P45S probably benign Het
Myo15 T A 11: 60,501,701 S2157T probably damaging Het
Olfr113 G T 17: 37,575,273 T50K probably damaging Het
Olfr193 T C 16: 59,110,604 E2G probably benign Het
Olfr374 T C 8: 72,109,779 V71A probably benign Het
Olfr721-ps1 T A 14: 14,407,880 Y217* probably null Het
Otogl A G 10: 107,798,357 I1419T possibly damaging Het
Ovol1 A T 19: 5,551,639 F118L probably damaging Het
Pak7 T C 2: 136,116,760 D136G probably damaging Het
Pik3r2 T C 8: 70,770,606 Y417C probably damaging Het
Ppp2r2a T C 14: 67,016,603 N372S probably benign Het
Prss30 G T 17: 23,972,832 N238K possibly damaging Het
Prss33 C A 17: 23,834,811 probably null Het
Ptpn4 T C 1: 119,765,058 E187G probably damaging Het
Ptprg A T 14: 12,207,357 N100I probably damaging Het
Rbpms2 T C 9: 65,651,042 V130A probably benign Het
Rdh7 A T 10: 127,888,612 M1K probably null Het
Rtp3 A C 9: 110,986,683 S205A probably benign Het
Scn9a T A 2: 66,483,459 T1972S probably benign Het
Scnn1b T C 7: 121,902,328 V122A probably benign Het
Slc15a4 A G 5: 127,608,979 L213S probably damaging Het
Slc27a5 T A 7: 12,991,246 I425F probably damaging Het
Spata31d1b A G 13: 59,716,628 D530G probably benign Het
Tcf25 T A 8: 123,381,550 S115T probably benign Het
Tet2 A G 3: 133,466,852 L1883P possibly damaging Het
Trim21 T A 7: 102,561,898 R205* probably null Het
Ttc23 G T 7: 67,725,321 probably null Het
Unc13d T C 11: 116,068,673 K658R probably null Het
Vmn1r43 A G 6: 89,869,590 F305L possibly damaging Het
Vmn2r2 A T 3: 64,117,130 C677S probably benign Het
Wnt5a T C 14: 28,518,343 M150T probably benign Het
Ythdc1 G A 5: 86,828,122 probably null Het
Zcchc6 T C 13: 59,799,903 E466G possibly damaging Het
Zdbf2 A T 1: 63,304,249 R596* probably null Het
Other mutations in Ryr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Ryr3 APN 2 112660149 missense probably damaging 0.98
IGL00531:Ryr3 APN 2 112663012 splice site probably benign
IGL00785:Ryr3 APN 2 112836103 missense possibly damaging 0.95
IGL00901:Ryr3 APN 2 112886589 missense probably damaging 1.00
IGL00910:Ryr3 APN 2 112728934 splice site probably benign
IGL00970:Ryr3 APN 2 112764676 missense probably damaging 1.00
IGL01083:Ryr3 APN 2 112751846 splice site probably benign
IGL01105:Ryr3 APN 2 112751805 missense probably damaging 1.00
IGL01287:Ryr3 APN 2 112709073 missense probably damaging 1.00
IGL01343:Ryr3 APN 2 112660054 missense probably damaging 1.00
IGL01472:Ryr3 APN 2 112672248 missense probably benign 0.20
IGL01552:Ryr3 APN 2 112825883 missense possibly damaging 0.53
IGL01594:Ryr3 APN 2 112772728 missense probably damaging 1.00
IGL01723:Ryr3 APN 2 112650111 critical splice donor site probably null
IGL01837:Ryr3 APN 2 112801320 missense probably damaging 1.00
IGL01868:Ryr3 APN 2 112803158 splice site probably benign
IGL01907:Ryr3 APN 2 112869001 splice site probably benign
IGL02005:Ryr3 APN 2 112663263 splice site probably benign
IGL02014:Ryr3 APN 2 112946915 missense possibly damaging 0.86
IGL02109:Ryr3 APN 2 112949157 missense probably benign
IGL02178:Ryr3 APN 2 112825799 missense probably benign 0.17
IGL02185:Ryr3 APN 2 112967203 missense probably damaging 0.99
IGL02189:Ryr3 APN 2 112754838 splice site probably benign
IGL02200:Ryr3 APN 2 112849510 missense probably damaging 0.98
IGL02302:Ryr3 APN 2 112964356 missense probably damaging 1.00
IGL02305:Ryr3 APN 2 112645277 missense probably damaging 0.96
IGL02306:Ryr3 APN 2 112834114 missense probably damaging 0.98
IGL02306:Ryr3 APN 2 112847399 critical splice donor site probably null
IGL02340:Ryr3 APN 2 112947004 splice site probably benign
IGL02398:Ryr3 APN 2 112847422 missense probably benign 0.05
IGL02407:Ryr3 APN 2 112754958 missense probably damaging 1.00
IGL02426:Ryr3 APN 2 112900905 missense possibly damaging 0.59
IGL02452:Ryr3 APN 2 112833990 missense probably damaging 1.00
IGL02453:Ryr3 APN 2 112681728 splice site probably benign
IGL02585:Ryr3 APN 2 112712303 missense probably damaging 1.00
IGL02724:Ryr3 APN 2 112902576 critical splice donor site probably null
IGL02817:Ryr3 APN 2 112844623 critical splice donor site probably null
IGL02861:Ryr3 APN 2 112652841 missense possibly damaging 0.89
IGL03038:Ryr3 APN 2 112668120 missense possibly damaging 0.83
IGL03059:Ryr3 APN 2 112800047 missense probably damaging 1.00
IGL03136:Ryr3 APN 2 112675974 splice site probably benign
IGL03137:Ryr3 APN 2 112910397 missense probably benign
IGL03166:Ryr3 APN 2 112641112 nonsense probably null
IGL03177:Ryr3 APN 2 113028671 missense probably benign 0.39
IGL03205:Ryr3 APN 2 112632142 missense probably damaging 1.00
IGL03224:Ryr3 APN 2 112954336 nonsense probably null
IGL03249:Ryr3 APN 2 112640656 missense probably benign 0.32
IGL03370:Ryr3 APN 2 112756599 missense possibly damaging 0.69
ANU74:Ryr3 UTSW 2 112831230 critical splice acceptor site probably null
F5426:Ryr3 UTSW 2 112766338 splice site probably benign
PIT4494001:Ryr3 UTSW 2 112841876 missense probably damaging 0.99
R0022:Ryr3 UTSW 2 112640666 missense probably damaging 1.00
R0022:Ryr3 UTSW 2 112640666 missense probably damaging 1.00
R0051:Ryr3 UTSW 2 112869075 missense probably damaging 1.00
R0051:Ryr3 UTSW 2 112869075 missense probably damaging 1.00
R0085:Ryr3 UTSW 2 112859763 missense probably damaging 1.00
R0097:Ryr3 UTSW 2 112800055 missense probably damaging 1.00
R0097:Ryr3 UTSW 2 112800055 missense probably damaging 1.00
R0098:Ryr3 UTSW 2 112901031 missense probably damaging 1.00
R0098:Ryr3 UTSW 2 112901031 missense probably damaging 1.00
R0116:Ryr3 UTSW 2 112803165 missense probably damaging 0.99
R0281:Ryr3 UTSW 2 112686810 missense probably damaging 1.00
R0302:Ryr3 UTSW 2 112647123 splice site probably benign
R0306:Ryr3 UTSW 2 112775655 critical splice donor site probably null
R0445:Ryr3 UTSW 2 112866054 missense probably benign 0.16
R0463:Ryr3 UTSW 2 112661701 missense probably damaging 1.00
R0592:Ryr3 UTSW 2 112678481 missense probably damaging 1.00
R0622:Ryr3 UTSW 2 112662555 missense probably damaging 1.00
R0656:Ryr3 UTSW 2 112648306 splice site probably benign
R0735:Ryr3 UTSW 2 112732982 missense probably benign 0.11
R0783:Ryr3 UTSW 2 112756327 splice site probably benign
R0789:Ryr3 UTSW 2 112780973 splice site probably null
R0835:Ryr3 UTSW 2 112650138 missense probably benign 0.16
R0879:Ryr3 UTSW 2 113030243 missense probably benign 0.02
R0924:Ryr3 UTSW 2 112841833 missense probably damaging 1.00
R0930:Ryr3 UTSW 2 112841833 missense probably damaging 1.00
R0931:Ryr3 UTSW 2 112653702 missense probably damaging 1.00
R1037:Ryr3 UTSW 2 112869108 missense probably benign 0.42
R1169:Ryr3 UTSW 2 112733014 missense probably benign 0.01
R1170:Ryr3 UTSW 2 112946987 missense probably damaging 1.00
R1178:Ryr3 UTSW 2 112964380 missense probably benign 0.00
R1187:Ryr3 UTSW 2 112958176 missense probably damaging 1.00
R1289:Ryr3 UTSW 2 112645285 missense probably damaging 1.00
R1337:Ryr3 UTSW 2 112779963 missense possibly damaging 0.46
R1342:Ryr3 UTSW 2 112750803 missense probably damaging 1.00
R1349:Ryr3 UTSW 2 112834201 missense probably damaging 1.00
R1372:Ryr3 UTSW 2 112834201 missense probably damaging 1.00
R1434:Ryr3 UTSW 2 112645259 missense probably damaging 1.00
R1438:Ryr3 UTSW 2 112757701 missense probably benign 0.18
R1467:Ryr3 UTSW 2 112753002 splice site probably benign
R1470:Ryr3 UTSW 2 112653007 missense probably benign
R1470:Ryr3 UTSW 2 112653007 missense probably benign
R1474:Ryr3 UTSW 2 112909962 missense probably damaging 1.00
R1481:Ryr3 UTSW 2 112636522 splice site probably benign
R1513:Ryr3 UTSW 2 112709197 nonsense probably null
R1524:Ryr3 UTSW 2 112869082 missense probably damaging 0.98
R1525:Ryr3 UTSW 2 112678090 missense probably damaging 1.00
R1526:Ryr3 UTSW 2 112661657 missense probably damaging 1.00
R1611:Ryr3 UTSW 2 112653505 missense possibly damaging 0.72
R1640:Ryr3 UTSW 2 112900833 missense probably damaging 1.00
R1764:Ryr3 UTSW 2 112860460 missense probably damaging 1.00
R1769:Ryr3 UTSW 2 112751768 critical splice donor site probably null
R1776:Ryr3 UTSW 2 112957253 missense probably damaging 0.99
R1780:Ryr3 UTSW 2 112867292 missense probably damaging 0.98
R1840:Ryr3 UTSW 2 112750820 missense probably damaging 1.00
R1864:Ryr3 UTSW 2 112730328 missense possibly damaging 0.65
R1872:Ryr3 UTSW 2 112709137 missense possibly damaging 0.94
R1960:Ryr3 UTSW 2 112794467 missense probably damaging 1.00
R1994:Ryr3 UTSW 2 112654492 missense probably null 0.93
R2018:Ryr3 UTSW 2 112781065 missense probably benign 0.24
R2019:Ryr3 UTSW 2 112781065 missense probably benign 0.24
R2029:Ryr3 UTSW 2 112647016 missense possibly damaging 0.82
R2051:Ryr3 UTSW 2 112756641 missense probably damaging 1.00
R2060:Ryr3 UTSW 2 112954364 missense possibly damaging 0.92
R2061:Ryr3 UTSW 2 112663004 missense possibly damaging 0.83
R2067:Ryr3 UTSW 2 112946957 missense probably damaging 1.00
R2106:Ryr3 UTSW 2 112638129 missense probably damaging 1.00
R2129:Ryr3 UTSW 2 112678370 splice site probably benign
R2140:Ryr3 UTSW 2 112875148 missense probably benign 0.01
R2176:Ryr3 UTSW 2 112666335 missense possibly damaging 0.48
R2241:Ryr3 UTSW 2 112801392 missense probably damaging 1.00
R2261:Ryr3 UTSW 2 112675873 missense probably damaging 0.99
R2262:Ryr3 UTSW 2 112675873 missense probably damaging 0.99
R2276:Ryr3 UTSW 2 112649319 missense possibly damaging 0.79
R2279:Ryr3 UTSW 2 112649319 missense possibly damaging 0.79
R2403:Ryr3 UTSW 2 112686628 missense probably damaging 1.00
R2510:Ryr3 UTSW 2 112675904 missense probably benign 0.18
R2568:Ryr3 UTSW 2 112675874 missense probably damaging 1.00
R3013:Ryr3 UTSW 2 112640281 missense probably damaging 1.00
R3431:Ryr3 UTSW 2 112656531 missense probably damaging 1.00
R3552:Ryr3 UTSW 2 112751787 missense probably damaging 1.00
R3761:Ryr3 UTSW 2 112754913 missense probably benign
R3909:Ryr3 UTSW 2 112636608 missense probably damaging 1.00
R3923:Ryr3 UTSW 2 112841873 missense possibly damaging 0.92
R3924:Ryr3 UTSW 2 113028703 splice site probably benign
R3927:Ryr3 UTSW 2 112675873 missense probably damaging 0.99
R3947:Ryr3 UTSW 2 112675873 missense probably damaging 0.99
R3949:Ryr3 UTSW 2 112675873 missense probably damaging 0.99
R3976:Ryr3 UTSW 2 112675837 missense possibly damaging 0.49
R4004:Ryr3 UTSW 2 112675873 missense probably damaging 0.99
R4022:Ryr3 UTSW 2 112675873 missense probably damaging 0.99
R4084:Ryr3 UTSW 2 112900908 missense probably damaging 0.99
R4106:Ryr3 UTSW 2 112675873 missense probably damaging 0.99
R4108:Ryr3 UTSW 2 112675873 missense probably damaging 0.99
R4109:Ryr3 UTSW 2 112675873 missense probably damaging 0.99
R4131:Ryr3 UTSW 2 112926983 splice site probably null
R4156:Ryr3 UTSW 2 112653675 missense probably damaging 1.00
R4172:Ryr3 UTSW 2 112794470 missense probably damaging 1.00
R4234:Ryr3 UTSW 2 112910407 missense probably damaging 1.00
R4399:Ryr3 UTSW 2 112946844 missense probably benign 0.01
R4409:Ryr3 UTSW 2 112730308 missense probably damaging 1.00
R4418:Ryr3 UTSW 2 112831224 missense probably damaging 1.00
R4466:Ryr3 UTSW 2 112653102 missense possibly damaging 0.92
R4525:Ryr3 UTSW 2 112653621 missense probably damaging 0.98
R4573:Ryr3 UTSW 2 112755174 splice site probably null
R4589:Ryr3 UTSW 2 112875133 missense probably damaging 1.00
R4653:Ryr3 UTSW 2 112652763 missense probably damaging 1.00
R4664:Ryr3 UTSW 2 112996555 intron probably benign
R4710:Ryr3 UTSW 2 112766301 missense probably damaging 1.00
R4734:Ryr3 UTSW 2 112910502 missense probably damaging 0.99
R4741:Ryr3 UTSW 2 112803268 missense probably damaging 0.99
R4748:Ryr3 UTSW 2 112964405 missense possibly damaging 0.95
R4749:Ryr3 UTSW 2 112964405 missense possibly damaging 0.95
R4754:Ryr3 UTSW 2 112757639 missense possibly damaging 0.94
R4764:Ryr3 UTSW 2 112733031 critical splice acceptor site probably null
R4812:Ryr3 UTSW 2 112912236 missense probably damaging 1.00
R4822:Ryr3 UTSW 2 112652745 missense probably damaging 1.00
R4841:Ryr3 UTSW 2 112648373 missense probably damaging 1.00
R4849:Ryr3 UTSW 2 112908462 missense probably damaging 1.00
R4917:Ryr3 UTSW 2 112831185 missense probably damaging 1.00
R4942:Ryr3 UTSW 2 112836257 missense probably damaging 0.99
R4990:Ryr3 UTSW 2 112635777 missense probably damaging 1.00
R4990:Ryr3 UTSW 2 112909973 missense probably damaging 1.00
R5049:Ryr3 UTSW 2 112640171 missense probably damaging 1.00
R5055:Ryr3 UTSW 2 112831159 missense probably benign 0.00
R5112:Ryr3 UTSW 2 112902665 missense probably damaging 1.00
R5160:Ryr3 UTSW 2 112646927 missense probably damaging 1.00
R5169:Ryr3 UTSW 2 112670660 missense possibly damaging 0.63
R5176:Ryr3 UTSW 2 112757667 missense possibly damaging 0.95
R5182:Ryr3 UTSW 2 112755150 missense probably damaging 1.00
R5206:Ryr3 UTSW 2 112844711 missense probably damaging 1.00
R5263:Ryr3 UTSW 2 112718002 missense possibly damaging 0.65
R5272:Ryr3 UTSW 2 112653213 missense probably damaging 1.00
R5332:Ryr3 UTSW 2 112902693 missense probably damaging 1.00
R5340:Ryr3 UTSW 2 112834125 missense probably damaging 0.99
R5359:Ryr3 UTSW 2 112775841 splice site probably null
R5434:Ryr3 UTSW 2 112794469 missense probably damaging 1.00
R5454:Ryr3 UTSW 2 112730302 splice site probably null
R5501:Ryr3 UTSW 2 112662504 missense possibly damaging 0.80
R5560:Ryr3 UTSW 2 112754877 missense probably damaging 1.00
R5580:Ryr3 UTSW 2 112841948 missense probably damaging 1.00
R5621:Ryr3 UTSW 2 112900984 nonsense probably null
R5731:Ryr3 UTSW 2 112641572 missense probably damaging 1.00
R5757:Ryr3 UTSW 2 112841975 missense probably damaging 1.00
R5758:Ryr3 UTSW 2 112841975 missense probably damaging 1.00
R5768:Ryr3 UTSW 2 112753097 missense probably benign 0.05
R5783:Ryr3 UTSW 2 112652998 missense probably benign 0.06
R5799:Ryr3 UTSW 2 112686580 missense probably damaging 1.00
R5829:Ryr3 UTSW 2 112859731 missense probably damaging 1.00
R5883:Ryr3 UTSW 2 113030292 intron probably benign
R5911:Ryr3 UTSW 2 112908487 missense probably damaging 1.00
R5968:Ryr3 UTSW 2 112647049 missense probably benign 0.22
R5972:Ryr3 UTSW 2 112834064 missense probably damaging 0.99
R5978:Ryr3 UTSW 2 112672269 missense probably benign 0.00
R6084:Ryr3 UTSW 2 112908493 missense probably damaging 1.00
R6117:Ryr3 UTSW 2 112635396 missense probably damaging 1.00
R6126:Ryr3 UTSW 2 112757670 missense probably damaging 1.00
R6128:Ryr3 UTSW 2 112954294 critical splice donor site probably null
R6157:Ryr3 UTSW 2 112841899 missense probably damaging 0.98
R6258:Ryr3 UTSW 2 112660104 missense probably damaging 1.00
R6260:Ryr3 UTSW 2 112660104 missense probably damaging 1.00
R6373:Ryr3 UTSW 2 112656544 missense probably damaging 1.00
R6377:Ryr3 UTSW 2 112632185 missense probably damaging 1.00
R6443:Ryr3 UTSW 2 112675933 missense possibly damaging 0.88
R6478:Ryr3 UTSW 2 112660068 missense probably damaging 1.00
R6512:Ryr3 UTSW 2 112867378 missense possibly damaging 0.83
R6684:Ryr3 UTSW 2 112753088 missense probably damaging 1.00
R6753:Ryr3 UTSW 2 112652610 missense probably damaging 0.99
R6812:Ryr3 UTSW 2 112946906 missense probably damaging 1.00
R6910:Ryr3 UTSW 2 112958175 missense probably damaging 1.00
R6930:Ryr3 UTSW 2 112860354 missense probably damaging 1.00
R6946:Ryr3 UTSW 2 112831200 missense probably damaging 1.00
R6950:Ryr3 UTSW 2 112686825 missense possibly damaging 0.78
R6973:Ryr3 UTSW 2 112766311 missense probably damaging 0.99
R6984:Ryr3 UTSW 2 112875091 missense probably damaging 1.00
R7020:Ryr3 UTSW 2 112753078 missense probably benign 0.00
R7037:Ryr3 UTSW 2 112949130 nonsense probably null
R7166:Ryr3 UTSW 2 112875028 missense probably damaging 1.00
R7172:Ryr3 UTSW 2 112661657 missense probably damaging 1.00
R7177:Ryr3 UTSW 2 112900843 missense probably damaging 1.00
R7188:Ryr3 UTSW 2 113028644 missense probably damaging 1.00
R7202:Ryr3 UTSW 2 112766319 missense probably damaging 1.00
R7228:Ryr3 UTSW 2 112861852 missense probably damaging 1.00
R7256:Ryr3 UTSW 2 112672246 nonsense probably null
R7293:Ryr3 UTSW 2 112902603 missense probably benign 0.13
R7331:Ryr3 UTSW 2 112763665 missense possibly damaging 0.80
R7380:Ryr3 UTSW 2 112640157 missense probably damaging 1.00
R7391:Ryr3 UTSW 2 112780977 critical splice donor site probably null
R7455:Ryr3 UTSW 2 112728866 missense probably damaging 0.99
R7466:Ryr3 UTSW 2 112926957 missense probably benign 0.40
R7481:Ryr3 UTSW 2 112678093 missense probably benign 0.16
R7481:Ryr3 UTSW 2 112678094 missense possibly damaging 0.95
R7497:Ryr3 UTSW 2 112730473 missense probably benign 0.06
R7502:Ryr3 UTSW 2 112712361 missense probably benign 0.00
R7505:Ryr3 UTSW 2 112712429 missense probably damaging 0.99
R7581:Ryr3 UTSW 2 112753027 missense probably damaging 0.99
R7606:Ryr3 UTSW 2 112645245 nonsense probably null
R7677:Ryr3 UTSW 2 112833900 missense probably benign
R7703:Ryr3 UTSW 2 112859765 missense probably damaging 1.00
R7713:Ryr3 UTSW 2 112635346 missense probably benign 0.12
X0057:Ryr3 UTSW 2 112640159 missense probably damaging 1.00
X0064:Ryr3 UTSW 2 112912302 missense probably benign 0.26
Z1088:Ryr3 UTSW 2 112900916 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCAGCTTCCAGACAACTCCTTC -3'
(R):5'- CTGGATTCCTGCTTCACTGTGGAC -3'

Sequencing Primer
(F):5'- TTGTCCACATAGCGGATCAG -3'
(R):5'- CACTGTGGACTTGGGAGAG -3'
Posted On2014-05-09