Incidental Mutation 'R1662:Evc2'
ID186829
Institutional Source Beutler Lab
Gene Symbol Evc2
Ensembl Gene ENSMUSG00000050248
Gene NameEvC ciliary complex subunit 2
SynonymsLbn, limbin
MMRRC Submission 039698-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1662 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location37338499-37425055 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37348750 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 138 (T138A)
Ref Sequence ENSEMBL: ENSMUSP00000055130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056365]
Predicted Effect probably benign
Transcript: ENSMUST00000056365
AA Change: T138A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000055130
Gene: ENSMUSG00000050248
AA Change: T138A

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 40 59 N/A INTRINSIC
Pfam:EVC2_like 147 570 2.1e-191 PFAM
low complexity region 576 600 N/A INTRINSIC
coiled coil region 617 644 N/A INTRINSIC
low complexity region 780 791 N/A INTRINSIC
low complexity region 902 914 N/A INTRINSIC
coiled coil region 922 956 N/A INTRINSIC
low complexity region 1057 1071 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000101258
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions in bone formation and skeletal development. Mutations in this gene, as well as in a neighboring gene that lies in a head-to-head configuration, cause Ellis-van Creveld syndrome, an autosomal recessive skeletal dysplasia that is also known as chondroectodermal dysplasia. Mutations in this gene also cause acrofacial dysostosis Weyers type, also referred to as Curry-Hall syndrome, a disease that combines limb and facial abnormalities. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit perinatal lethality, short limbs and ribs, decreased osteoblast differentiation and abnormal chondrocyte physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730409E04Rik T A 4: 126,611,682 M1K probably null Het
5730507C01Rik A C 12: 18,531,966 R119S possibly damaging Het
Abca1 T A 4: 53,090,251 probably null Het
Aff1 G A 5: 103,841,057 G830D probably damaging Het
AI987944 T C 7: 41,374,449 T369A possibly damaging Het
Aoah A G 13: 21,000,113 probably null Het
Arhgap40 C G 2: 158,539,270 C349W probably damaging Het
Atic T A 1: 71,576,127 D438E probably benign Het
Barhl2 A T 5: 106,453,499 M338K probably benign Het
Btd T C 14: 31,666,790 V156A probably damaging Het
Ccdc82 T C 9: 13,262,772 V319A probably damaging Het
Celsr1 G T 15: 86,031,062 N903K probably damaging Het
Cenpf T A 1: 189,657,771 N1288I probably damaging Het
Ciao1 G A 2: 127,244,937 T252I probably benign Het
Cma2 T C 14: 55,973,116 C87R probably damaging Het
Cops7a T A 6: 124,962,438 R83W probably damaging Het
Cxcr6 A T 9: 123,810,548 M205L possibly damaging Het
Dcc A G 18: 71,420,338 L749P probably benign Het
Dync1i2 C T 2: 71,250,979 T484I possibly damaging Het
Epas1 A T 17: 86,829,027 K742N probably damaging Het
F5 T C 1: 164,207,888 I1877T probably damaging Het
Fat1 T G 8: 44,953,164 V984G probably benign Het
Fat4 T A 3: 38,980,779 V2860D probably damaging Het
Foxn4 C T 5: 114,256,894 R324Q probably benign Het
Gapdhs C T 7: 30,737,002 R120H probably damaging Het
Gcnt3 T C 9: 70,034,377 D303G probably benign Het
Gm16432 A G 1: 178,046,986 K140E unknown Het
Gng11 A T 6: 4,008,066 Y43F probably benign Het
Hectd4 A C 5: 121,317,245 M651L probably benign Het
Ifngr2 T A 16: 91,560,596 Y200N probably benign Het
Iqgap3 T C 3: 88,098,401 V512A probably benign Het
Kdm2a A C 19: 4,328,212 D187E probably damaging Het
Klhl8 A G 5: 103,872,045 V370A probably damaging Het
Kmt2a G A 9: 44,836,670 probably benign Het
Krt12 C A 11: 99,420,824 V184F probably benign Het
Lrrc8c A T 5: 105,606,757 I133F probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Map1a C G 2: 121,306,408 S2568R possibly damaging Het
Mbnl1 C A 3: 60,625,172 Q301K probably damaging Het
Med12l A T 3: 59,093,617 K724N probably damaging Het
Mroh2a A C 1: 88,241,618 I672L probably benign Het
Mybph C T 1: 134,193,636 P45S probably benign Het
Myo15 T A 11: 60,501,701 S2157T probably damaging Het
Olfr113 G T 17: 37,575,273 T50K probably damaging Het
Olfr193 T C 16: 59,110,604 E2G probably benign Het
Olfr374 T C 8: 72,109,779 V71A probably benign Het
Olfr721-ps1 T A 14: 14,407,880 Y217* probably null Het
Otogl A G 10: 107,798,357 I1419T possibly damaging Het
Ovol1 A T 19: 5,551,639 F118L probably damaging Het
Pak7 T C 2: 136,116,760 D136G probably damaging Het
Pik3r2 T C 8: 70,770,606 Y417C probably damaging Het
Ppp2r2a T C 14: 67,016,603 N372S probably benign Het
Prss30 G T 17: 23,972,832 N238K possibly damaging Het
Prss33 C A 17: 23,834,811 probably null Het
Ptpn4 T C 1: 119,765,058 E187G probably damaging Het
Ptprg A T 14: 12,207,357 N100I probably damaging Het
Rbpms2 T C 9: 65,651,042 V130A probably benign Het
Rdh7 A T 10: 127,888,612 M1K probably null Het
Rtp3 A C 9: 110,986,683 S205A probably benign Het
Ryr3 G T 2: 112,709,273 D3207E probably damaging Het
Scn9a T A 2: 66,483,459 T1972S probably benign Het
Scnn1b T C 7: 121,902,328 V122A probably benign Het
Slc15a4 A G 5: 127,608,979 L213S probably damaging Het
Slc27a5 T A 7: 12,991,246 I425F probably damaging Het
Spata31d1b A G 13: 59,716,628 D530G probably benign Het
Tcf25 T A 8: 123,381,550 S115T probably benign Het
Tet2 A G 3: 133,466,852 L1883P possibly damaging Het
Trim21 T A 7: 102,561,898 R205* probably null Het
Ttc23 G T 7: 67,725,321 probably null Het
Unc13d T C 11: 116,068,673 K658R probably null Het
Vmn1r43 A G 6: 89,869,590 F305L possibly damaging Het
Vmn2r2 A T 3: 64,117,130 C677S probably benign Het
Wnt5a T C 14: 28,518,343 M150T probably benign Het
Ythdc1 G A 5: 86,828,122 probably null Het
Zcchc6 T C 13: 59,799,903 E466G possibly damaging Het
Zdbf2 A T 1: 63,304,249 R596* probably null Het
Other mutations in Evc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Evc2 APN 5 37421891 missense probably benign 0.26
IGL01294:Evc2 APN 5 37347510 critical splice donor site probably null
IGL01547:Evc2 APN 5 37393087 missense probably benign 0.09
IGL02233:Evc2 APN 5 37378337 missense probably damaging 0.99
IGL02253:Evc2 APN 5 37378427 splice site probably benign
IGL02993:Evc2 APN 5 37419157 missense probably benign 0.01
R0010:Evc2 UTSW 5 37417449 missense probably damaging 1.00
R0010:Evc2 UTSW 5 37417449 missense probably damaging 1.00
R0324:Evc2 UTSW 5 37393099 missense probably damaging 1.00
R0441:Evc2 UTSW 5 37417467 missense probably damaging 1.00
R0454:Evc2 UTSW 5 37417484 missense possibly damaging 0.78
R1291:Evc2 UTSW 5 37386815 missense probably damaging 1.00
R1433:Evc2 UTSW 5 37393083 missense probably damaging 1.00
R1485:Evc2 UTSW 5 37370556 missense probably benign 0.30
R1491:Evc2 UTSW 5 37393197 critical splice donor site probably null
R1502:Evc2 UTSW 5 37393096 missense probably benign
R1891:Evc2 UTSW 5 37392079 missense probably damaging 1.00
R1965:Evc2 UTSW 5 37363532 missense possibly damaging 0.73
R1983:Evc2 UTSW 5 37415931 nonsense probably null
R2160:Evc2 UTSW 5 37380518 missense possibly damaging 0.87
R2237:Evc2 UTSW 5 37378183 missense probably benign 0.22
R3926:Evc2 UTSW 5 37383230 missense probably damaging 1.00
R3953:Evc2 UTSW 5 37380587 critical splice donor site probably null
R3959:Evc2 UTSW 5 37415776 missense possibly damaging 0.63
R4281:Evc2 UTSW 5 37338594 missense probably benign 0.33
R4366:Evc2 UTSW 5 37338669 missense possibly damaging 0.93
R4707:Evc2 UTSW 5 37421860 missense probably benign 0.08
R4754:Evc2 UTSW 5 37387031 missense probably damaging 0.99
R5373:Evc2 UTSW 5 37378210 missense probably damaging 1.00
R5593:Evc2 UTSW 5 37386977 missense probably damaging 0.99
R5697:Evc2 UTSW 5 37370608 missense probably damaging 1.00
R5847:Evc2 UTSW 5 37404724 intron probably benign
R5874:Evc2 UTSW 5 37417539 intron probably benign
R6023:Evc2 UTSW 5 37348616 missense probably benign 0.13
R6285:Evc2 UTSW 5 37424579 missense possibly damaging 0.86
R6394:Evc2 UTSW 5 37378275 missense probably damaging 1.00
R6567:Evc2 UTSW 5 37419164 missense probably benign 0.17
R6669:Evc2 UTSW 5 37378378 missense possibly damaging 0.88
R7039:Evc2 UTSW 5 37421888 missense probably damaging 1.00
R7131:Evc2 UTSW 5 37410258 missense probably damaging 1.00
R7144:Evc2 UTSW 5 37386839 missense probably damaging 0.97
R7372:Evc2 UTSW 5 37387133 missense probably damaging 0.98
R7376:Evc2 UTSW 5 37370639 missense possibly damaging 0.57
R7607:Evc2 UTSW 5 37386856 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CGTGACAATGAGTTCCCTGCATCC -3'
(R):5'- AGAGAATGTCCCTGTGGCAGAGTG -3'

Sequencing Primer
(F):5'- GCTAAGTGAGGGTCAATATCTCC -3'
(R):5'- CCAATCCTCACTGAAGAGAGATGTG -3'
Posted On2014-05-09