Incidental Mutation 'R1662:Ythdc1'
ID186830
Institutional Source Beutler Lab
Gene Symbol Ythdc1
Ensembl Gene ENSMUSG00000035851
Gene NameYTH domain containing 1
SynonymsA730098D12Rik
MMRRC Submission 039698-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R1662 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location86804221-86836659 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 86828122 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038384] [ENSMUST00000119339] [ENSMUST00000120498] [ENSMUST00000156363]
Predicted Effect probably null
Transcript: ENSMUST00000038384
SMART Domains Protein: ENSMUSP00000039133
Gene: ENSMUSG00000035851

DomainStartEndE-ValueType
SCOP:d1qbkb_ 225 249 6e-3 SMART
low complexity region 269 280 N/A INTRINSIC
low complexity region 316 330 N/A INTRINSIC
Pfam:YTH 356 494 5e-42 PFAM
low complexity region 516 540 N/A INTRINSIC
low complexity region 609 622 N/A INTRINSIC
low complexity region 625 645 N/A INTRINSIC
low complexity region 682 736 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000119339
SMART Domains Protein: ENSMUSP00000113000
Gene: ENSMUSG00000035851

DomainStartEndE-ValueType
SCOP:d1qbkb_ 225 249 6e-3 SMART
low complexity region 269 280 N/A INTRINSIC
Pfam:YTH 337 478 4.4e-44 PFAM
low complexity region 498 522 N/A INTRINSIC
low complexity region 583 596 N/A INTRINSIC
low complexity region 599 619 N/A INTRINSIC
low complexity region 656 710 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000120498
SMART Domains Protein: ENSMUSP00000113951
Gene: ENSMUSG00000035851

DomainStartEndE-ValueType
SCOP:d1qbkb_ 225 249 6e-3 SMART
low complexity region 269 280 N/A INTRINSIC
low complexity region 316 330 N/A INTRINSIC
Pfam:YTH 355 496 4.6e-44 PFAM
low complexity region 516 540 N/A INTRINSIC
low complexity region 601 614 N/A INTRINSIC
low complexity region 617 637 N/A INTRINSIC
low complexity region 674 728 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123625
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148142
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151489
Predicted Effect silent
Transcript: ENSMUST00000156363
SMART Domains Protein: ENSMUSP00000122491
Gene: ENSMUSG00000035851

DomainStartEndE-ValueType
SCOP:d1qbkb_ 237 261 8e-3 SMART
low complexity region 281 292 N/A INTRINSIC
Pfam:YTH 350 488 3e-42 PFAM
low complexity region 510 525 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730409E04Rik T A 4: 126,611,682 M1K probably null Het
5730507C01Rik A C 12: 18,531,966 R119S possibly damaging Het
Abca1 T A 4: 53,090,251 probably null Het
Aff1 G A 5: 103,841,057 G830D probably damaging Het
AI987944 T C 7: 41,374,449 T369A possibly damaging Het
Aoah A G 13: 21,000,113 probably null Het
Arhgap40 C G 2: 158,539,270 C349W probably damaging Het
Atic T A 1: 71,576,127 D438E probably benign Het
Barhl2 A T 5: 106,453,499 M338K probably benign Het
Btd T C 14: 31,666,790 V156A probably damaging Het
Ccdc82 T C 9: 13,262,772 V319A probably damaging Het
Celsr1 G T 15: 86,031,062 N903K probably damaging Het
Cenpf T A 1: 189,657,771 N1288I probably damaging Het
Ciao1 G A 2: 127,244,937 T252I probably benign Het
Cma2 T C 14: 55,973,116 C87R probably damaging Het
Cops7a T A 6: 124,962,438 R83W probably damaging Het
Cxcr6 A T 9: 123,810,548 M205L possibly damaging Het
Dcc A G 18: 71,420,338 L749P probably benign Het
Dync1i2 C T 2: 71,250,979 T484I possibly damaging Het
Epas1 A T 17: 86,829,027 K742N probably damaging Het
Evc2 A G 5: 37,348,750 T138A probably benign Het
F5 T C 1: 164,207,888 I1877T probably damaging Het
Fat1 T G 8: 44,953,164 V984G probably benign Het
Fat4 T A 3: 38,980,779 V2860D probably damaging Het
Foxn4 C T 5: 114,256,894 R324Q probably benign Het
Gapdhs C T 7: 30,737,002 R120H probably damaging Het
Gcnt3 T C 9: 70,034,377 D303G probably benign Het
Gm16432 A G 1: 178,046,986 K140E unknown Het
Gng11 A T 6: 4,008,066 Y43F probably benign Het
Hectd4 A C 5: 121,317,245 M651L probably benign Het
Ifngr2 T A 16: 91,560,596 Y200N probably benign Het
Iqgap3 T C 3: 88,098,401 V512A probably benign Het
Kdm2a A C 19: 4,328,212 D187E probably damaging Het
Klhl8 A G 5: 103,872,045 V370A probably damaging Het
Kmt2a G A 9: 44,836,670 probably benign Het
Krt12 C A 11: 99,420,824 V184F probably benign Het
Lrrc8c A T 5: 105,606,757 I133F probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Map1a C G 2: 121,306,408 S2568R possibly damaging Het
Mbnl1 C A 3: 60,625,172 Q301K probably damaging Het
Med12l A T 3: 59,093,617 K724N probably damaging Het
Mroh2a A C 1: 88,241,618 I672L probably benign Het
Mybph C T 1: 134,193,636 P45S probably benign Het
Myo15 T A 11: 60,501,701 S2157T probably damaging Het
Olfr113 G T 17: 37,575,273 T50K probably damaging Het
Olfr193 T C 16: 59,110,604 E2G probably benign Het
Olfr374 T C 8: 72,109,779 V71A probably benign Het
Olfr721-ps1 T A 14: 14,407,880 Y217* probably null Het
Otogl A G 10: 107,798,357 I1419T possibly damaging Het
Ovol1 A T 19: 5,551,639 F118L probably damaging Het
Pak7 T C 2: 136,116,760 D136G probably damaging Het
Pik3r2 T C 8: 70,770,606 Y417C probably damaging Het
Ppp2r2a T C 14: 67,016,603 N372S probably benign Het
Prss30 G T 17: 23,972,832 N238K possibly damaging Het
Prss33 C A 17: 23,834,811 probably null Het
Ptpn4 T C 1: 119,765,058 E187G probably damaging Het
Ptprg A T 14: 12,207,357 N100I probably damaging Het
Rbpms2 T C 9: 65,651,042 V130A probably benign Het
Rdh7 A T 10: 127,888,612 M1K probably null Het
Rtp3 A C 9: 110,986,683 S205A probably benign Het
Ryr3 G T 2: 112,709,273 D3207E probably damaging Het
Scn9a T A 2: 66,483,459 T1972S probably benign Het
Scnn1b T C 7: 121,902,328 V122A probably benign Het
Slc15a4 A G 5: 127,608,979 L213S probably damaging Het
Slc27a5 T A 7: 12,991,246 I425F probably damaging Het
Spata31d1b A G 13: 59,716,628 D530G probably benign Het
Tcf25 T A 8: 123,381,550 S115T probably benign Het
Tet2 A G 3: 133,466,852 L1883P possibly damaging Het
Trim21 T A 7: 102,561,898 R205* probably null Het
Ttc23 G T 7: 67,725,321 probably null Het
Unc13d T C 11: 116,068,673 K658R probably null Het
Vmn1r43 A G 6: 89,869,590 F305L possibly damaging Het
Vmn2r2 A T 3: 64,117,130 C677S probably benign Het
Wnt5a T C 14: 28,518,343 M150T probably benign Het
Zcchc6 T C 13: 59,799,903 E466G possibly damaging Het
Zdbf2 A T 1: 63,304,249 R596* probably null Het
Other mutations in Ythdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00676:Ythdc1 APN 5 86831811 missense probably damaging 1.00
IGL02222:Ythdc1 APN 5 86828043 missense possibly damaging 0.72
R0091:Ythdc1 UTSW 5 86820701 intron probably benign
R0311:Ythdc1 UTSW 5 86835705 missense probably damaging 0.97
R0349:Ythdc1 UTSW 5 86835720 missense probably damaging 1.00
R0630:Ythdc1 UTSW 5 86809348 splice site probably benign
R1907:Ythdc1 UTSW 5 86830630 missense probably damaging 1.00
R2100:Ythdc1 UTSW 5 86816685 missense possibly damaging 0.62
R2911:Ythdc1 UTSW 5 86816559 missense possibly damaging 0.95
R3692:Ythdc1 UTSW 5 86822667 missense probably damaging 0.98
R4042:Ythdc1 UTSW 5 86816524 missense probably benign 0.03
R4398:Ythdc1 UTSW 5 86815654 missense possibly damaging 0.95
R4398:Ythdc1 UTSW 5 86835820 utr 3 prime probably benign
R4608:Ythdc1 UTSW 5 86822808 missense probably damaging 0.97
R4806:Ythdc1 UTSW 5 86822845 missense probably damaging 0.99
R5291:Ythdc1 UTSW 5 86835688 missense probably damaging 1.00
R5761:Ythdc1 UTSW 5 86835951 utr 3 prime probably benign
R6180:Ythdc1 UTSW 5 86828094 missense possibly damaging 0.91
R6249:Ythdc1 UTSW 5 86831956 missense possibly damaging 0.94
R6560:Ythdc1 UTSW 5 86816608 missense probably benign 0.06
R7145:Ythdc1 UTSW 5 86816608 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ACTTGAATGTGGAACTCAGCTTTGTCT -3'
(R):5'- CTAGCCTGTTCTTAGCAACAAAATGCC -3'

Sequencing Primer
(F):5'- TTCTGTTTCCCCCTGATGAAAG -3'
(R):5'- TTCTGCATTAGGAAAGATCCCC -3'
Posted On2014-05-09