Mutagenetix > Incidental Mutations

Incidental Mutation 'R1662:Slc15a4'

186837

Institutional Source

Beutler Lab

Gene Symbol

Slc15a4

Ensembl Gene

ENSMUSG00000029416

Gene Name

solute carrier family 15, member 4

Synonyms

PHT1, C130069N12Rik, PTR4

MMRRC Submission

039698-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.084) question?

Stock #

R1662 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

127595664-127632897 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 127608979 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Serine at position 213 (L213S)

Ref Sequence

ENSEMBL: ENSMUSP00000123116 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031367] [ENSMUST00000152727] [ENSMUST00000153832] [ENSMUST00000155321]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000031367
AA Change: L213S

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000031367
Gene: ENSMUSG00000029416
AA Change: L213S

Domain	Start	End	E-Value	Type
low complexity region	10	29	N/A	INTRINSIC
Pfam:MFS_1	33	505	7.8e-13	PFAM
Pfam:PTR2	96	519	3.6e-127	PFAM
transmembrane domain	533	555	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000124569
AA Change: L165S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000121595
Gene: ENSMUSG00000029416
AA Change: L165S

Domain	Start	End	E-Value	Type
transmembrane domain	20	42	N/A	INTRINSIC
Pfam:PTR2	49	242	8.1e-56	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000144603
AA Change: L43S

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000116420
Gene: ENSMUSG00000029416
AA Change: L43S

Domain	Start	End	E-Value	Type
Pfam:PTR2	7	127	2.2e-38	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000152727

SMART Domains

Protein: ENSMUSP00000116529
Gene: ENSMUSG00000029416

Domain	Start	End	E-Value	Type
Pfam:PTR2	1	81	3.9e-15	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000153832
AA Change: L213S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000123116
Gene: ENSMUSG00000029416
AA Change: L213S

Domain	Start	End	E-Value	Type
low complexity region	10	29	N/A	INTRINSIC
low complexity region	32	43	N/A	INTRINSIC
transmembrane domain	67	89	N/A	INTRINSIC
Pfam:PTR2	96	292	5e-52	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000155321
AA Change: L44S

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000117258
Gene: ENSMUSG00000029416
AA Change: L44S

Domain	Start	End	E-Value	Type
Pfam:PTR2	7	105	1e-31	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000198486

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198727

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199810

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200212

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.2%
20x: 92.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for an ENU-induced mutation display abrogation of both Toll-like receptor (TLR)-induced type I IFN and proinflammatory cytokine production by plasmacytoid dendritic cells. Conventional dendritic cells respond normally to TLR ligands. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730409E04Rik	T	A	4: 126,611,682	M1K	probably null	Het
5730507C01Rik	A	C	12: 18,531,966	R119S	possibly damaging	Het
Abca1	T	A	4: 53,090,251		probably null	Het
Aff1	G	A	5: 103,841,057	G830D	probably damaging	Het
AI987944	T	C	7: 41,374,449	T369A	possibly damaging	Het
Aoah	A	G	13: 21,000,113		probably null	Het
Arhgap40	C	G	2: 158,539,270	C349W	probably damaging	Het
Atic	T	A	1: 71,576,127	D438E	probably benign	Het
Barhl2	A	T	5: 106,453,499	M338K	probably benign	Het
Btd	T	C	14: 31,666,790	V156A	probably damaging	Het
Ccdc82	T	C	9: 13,262,772	V319A	probably damaging	Het
Celsr1	G	T	15: 86,031,062	N903K	probably damaging	Het
Cenpf	T	A	1: 189,657,771	N1288I	probably damaging	Het
Ciao1	G	A	2: 127,244,937	T252I	probably benign	Het
Cma2	T	C	14: 55,973,116	C87R	probably damaging	Het
Cops7a	T	A	6: 124,962,438	R83W	probably damaging	Het
Cxcr6	A	T	9: 123,810,548	M205L	possibly damaging	Het
Dcc	A	G	18: 71,420,338	L749P	probably benign	Het
Dync1i2	C	T	2: 71,250,979	T484I	possibly damaging	Het
Epas1	A	T	17: 86,829,027	K742N	probably damaging	Het
Evc2	A	G	5: 37,348,750	T138A	probably benign	Het
F5	T	C	1: 164,207,888	I1877T	probably damaging	Het
Fat1	T	G	8: 44,953,164	V984G	probably benign	Het
Fat4	T	A	3: 38,980,779	V2860D	probably damaging	Het
Foxn4	C	T	5: 114,256,894	R324Q	probably benign	Het
Gapdhs	C	T	7: 30,737,002	R120H	probably damaging	Het
Gcnt3	T	C	9: 70,034,377	D303G	probably benign	Het
Gm16432	A	G	1: 178,046,986	K140E	unknown	Het
Gng11	A	T	6: 4,008,066	Y43F	probably benign	Het
Hectd4	A	C	5: 121,317,245	M651L	probably benign	Het
Ifngr2	T	A	16: 91,560,596	Y200N	probably benign	Het
Iqgap3	T	C	3: 88,098,401	V512A	probably benign	Het
Kdm2a	A	C	19: 4,328,212	D187E	probably damaging	Het
Klhl8	A	G	5: 103,872,045	V370A	probably damaging	Het
Kmt2a	G	A	9: 44,836,670		probably benign	Het
Krt12	C	A	11: 99,420,824	V184F	probably benign	Het
Lrrc8c	A	T	5: 105,606,757	I133F	probably benign	Het
Lsmem1	GTACATACATACATACATACATACATACA	GTACATACATACATACATACATACATACATACA	12: 40,185,261		probably null	Het
Map1a	C	G	2: 121,306,408	S2568R	possibly damaging	Het
Mbnl1	C	A	3: 60,625,172	Q301K	probably damaging	Het
Med12l	A	T	3: 59,093,617	K724N	probably damaging	Het
Mroh2a	A	C	1: 88,241,618	I672L	probably benign	Het
Mybph	C	T	1: 134,193,636	P45S	probably benign	Het
Myo15	T	A	11: 60,501,701	S2157T	probably damaging	Het
Olfr113	G	T	17: 37,575,273	T50K	probably damaging	Het
Olfr193	T	C	16: 59,110,604	E2G	probably benign	Het
Olfr374	T	C	8: 72,109,779	V71A	probably benign	Het
Olfr721-ps1	T	A	14: 14,407,880	Y217*	probably null	Het
Otogl	A	G	10: 107,798,357	I1419T	possibly damaging	Het
Ovol1	A	T	19: 5,551,639	F118L	probably damaging	Het
Pak7	T	C	2: 136,116,760	D136G	probably damaging	Het
Pik3r2	T	C	8: 70,770,606	Y417C	probably damaging	Het
Ppp2r2a	T	C	14: 67,016,603	N372S	probably benign	Het
Prss30	G	T	17: 23,972,832	N238K	possibly damaging	Het
Prss33	C	A	17: 23,834,811		probably null	Het
Ptpn4	T	C	1: 119,765,058	E187G	probably damaging	Het
Ptprg	A	T	14: 12,207,357	N100I	probably damaging	Het
Rbpms2	T	C	9: 65,651,042	V130A	probably benign	Het
Rdh7	A	T	10: 127,888,612	M1K	probably null	Het
Rtp3	A	C	9: 110,986,683	S205A	probably benign	Het
Ryr3	G	T	2: 112,709,273	D3207E	probably damaging	Het
Scn9a	T	A	2: 66,483,459	T1972S	probably benign	Het
Scnn1b	T	C	7: 121,902,328	V122A	probably benign	Het
Slc27a5	T	A	7: 12,991,246	I425F	probably damaging	Het
Spata31d1b	A	G	13: 59,716,628	D530G	probably benign	Het
Tcf25	T	A	8: 123,381,550	S115T	probably benign	Het
Tet2	A	G	3: 133,466,852	L1883P	possibly damaging	Het
Trim21	T	A	7: 102,561,898	R205*	probably null	Het
Ttc23	G	T	7: 67,725,321		probably null	Het
Unc13d	T	C	11: 116,068,673	K658R	probably null	Het
Vmn1r43	A	G	6: 89,869,590	F305L	possibly damaging	Het
Vmn2r2	A	T	3: 64,117,130	C677S	probably benign	Het
Wnt5a	T	C	14: 28,518,343	M150T	probably benign	Het
Ythdc1	G	A	5: 86,828,122		probably null	Het
Zcchc6	T	C	13: 59,799,903	E466G	possibly damaging	Het
Zdbf2	A	T	1: 63,304,249	R596*	probably null	Het

Other mutations in Slc15a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01475:Slc15a4	APN	5	127601960	missense	probably benign	0.13
IGL01543:Slc15a4	APN	5	127603766	missense	probably benign	0.12
IGL01805:Slc15a4	APN	5	127608836	missense	possibly damaging	0.91
IGL02958:Slc15a4	APN	5	127604665	missense	possibly damaging	0.93
IGL03367:Slc15a4	APN	5	127601941	missense	probably damaging	1.00
feeble	UTSW	5	127608770	unclassified	probably benign
R0018:Slc15a4	UTSW	5	127602010	missense	probably damaging	1.00
R0018:Slc15a4	UTSW	5	127602010	missense	probably damaging	1.00
R0838:Slc15a4	UTSW	5	127617003	missense	possibly damaging	0.53
R1544:Slc15a4	UTSW	5	127603768	missense	probably benign	0.01
R2504:Slc15a4	UTSW	5	127617239	missense	possibly damaging	0.92
R2843:Slc15a4	UTSW	5	127604536	critical splice donor site	probably null
R2845:Slc15a4	UTSW	5	127604536	critical splice donor site	probably null
R2846:Slc15a4	UTSW	5	127604536	critical splice donor site	probably null
R2900:Slc15a4	UTSW	5	127604536	critical splice donor site	probably null
R2971:Slc15a4	UTSW	5	127604536	critical splice donor site	probably null
R3018:Slc15a4	UTSW	5	127604536	critical splice donor site	probably null
R3020:Slc15a4	UTSW	5	127604536	critical splice donor site	probably null
R3021:Slc15a4	UTSW	5	127604536	critical splice donor site	probably null
R3027:Slc15a4	UTSW	5	127604536	critical splice donor site	probably null
R3053:Slc15a4	UTSW	5	127596682	missense	possibly damaging	0.83
R3155:Slc15a4	UTSW	5	127604536	critical splice donor site	probably null
R3432:Slc15a4	UTSW	5	127604536	critical splice donor site	probably null
R4356:Slc15a4	UTSW	5	127604536	critical splice donor site	probably null
R4357:Slc15a4	UTSW	5	127604536	critical splice donor site	probably null
R4359:Slc15a4	UTSW	5	127604536	critical splice donor site	probably null
R4448:Slc15a4	UTSW	5	127604536	critical splice donor site	probably null
R4449:Slc15a4	UTSW	5	127604536	critical splice donor site	probably null
R4450:Slc15a4	UTSW	5	127604536	critical splice donor site	probably null
R4514:Slc15a4	UTSW	5	127604536	critical splice donor site	probably null
R4544:Slc15a4	UTSW	5	127604536	critical splice donor site	probably null
R4546:Slc15a4	UTSW	5	127604536	critical splice donor site	probably null
R4952:Slc15a4	UTSW	5	127603837	missense	probably damaging	1.00
R5278:Slc15a4	UTSW	5	127616969	missense	probably damaging	0.99
R6393:Slc15a4	UTSW	5	127616886	missense	probably benign	0.13
R6527:Slc15a4	UTSW	5	127596709	missense	probably damaging	1.00
R7409:Slc15a4	UTSW	5	127604678	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- GAGCAAGGAGTTGTGTCACTCACC -3'
(R):5'- TGGCTTTTGTCAGGAGACTCGC -3'

Sequencing Primer
(F):5'- TCTCTGGGAGCAGCAACTG -3'
(R):5'- gagactcgctgaatctgtaaac -3'

Posted On

2014-05-09