Incidental Mutation 'R1662:Btd'
ID186876
Institutional Source Beutler Lab
Gene Symbol Btd
Ensembl Gene ENSMUSG00000021900
Gene Namebiotinidase
Synonyms
MMRRC Submission 039698-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R1662 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location31641028-31668579 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31666790 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 156 (V156A)
Ref Sequence ENSEMBL: ENSMUSP00000087608 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090147]
Predicted Effect probably damaging
Transcript: ENSMUST00000090147
AA Change: V156A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087608
Gene: ENSMUSG00000021900
AA Change: V156A

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:CN_hydrolase 63 287 3.9e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128014
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene functions to recycle protein-bound biotin by cleaving biocytin (biotin-epsilon-lysine), a normal product of carboxylase degradation, resulting in regeneration of free biotin. The encoded protein has also been shown to have biotinyl transferase activity. Mutations in this gene are associated with biotinidase deficiency. Multiple transcript variants encoding different isoforms have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit behavioral/neurological defects, weakness, bone loss, weight loss, and alopecia when fed a biotin-deprived diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730409E04Rik T A 4: 126,611,682 M1K probably null Het
5730507C01Rik A C 12: 18,531,966 R119S possibly damaging Het
Abca1 T A 4: 53,090,251 probably null Het
Aff1 G A 5: 103,841,057 G830D probably damaging Het
AI987944 T C 7: 41,374,449 T369A possibly damaging Het
Aoah A G 13: 21,000,113 probably null Het
Arhgap40 C G 2: 158,539,270 C349W probably damaging Het
Atic T A 1: 71,576,127 D438E probably benign Het
Barhl2 A T 5: 106,453,499 M338K probably benign Het
Ccdc82 T C 9: 13,262,772 V319A probably damaging Het
Celsr1 G T 15: 86,031,062 N903K probably damaging Het
Cenpf T A 1: 189,657,771 N1288I probably damaging Het
Ciao1 G A 2: 127,244,937 T252I probably benign Het
Cma2 T C 14: 55,973,116 C87R probably damaging Het
Cops7a T A 6: 124,962,438 R83W probably damaging Het
Cxcr6 A T 9: 123,810,548 M205L possibly damaging Het
Dcc A G 18: 71,420,338 L749P probably benign Het
Dync1i2 C T 2: 71,250,979 T484I possibly damaging Het
Epas1 A T 17: 86,829,027 K742N probably damaging Het
Evc2 A G 5: 37,348,750 T138A probably benign Het
F5 T C 1: 164,207,888 I1877T probably damaging Het
Fat1 T G 8: 44,953,164 V984G probably benign Het
Fat4 T A 3: 38,980,779 V2860D probably damaging Het
Foxn4 C T 5: 114,256,894 R324Q probably benign Het
Gapdhs C T 7: 30,737,002 R120H probably damaging Het
Gcnt3 T C 9: 70,034,377 D303G probably benign Het
Gm16432 A G 1: 178,046,986 K140E unknown Het
Gng11 A T 6: 4,008,066 Y43F probably benign Het
Hectd4 A C 5: 121,317,245 M651L probably benign Het
Ifngr2 T A 16: 91,560,596 Y200N probably benign Het
Iqgap3 T C 3: 88,098,401 V512A probably benign Het
Kdm2a A C 19: 4,328,212 D187E probably damaging Het
Klhl8 A G 5: 103,872,045 V370A probably damaging Het
Kmt2a G A 9: 44,836,670 probably benign Het
Krt12 C A 11: 99,420,824 V184F probably benign Het
Lrrc8c A T 5: 105,606,757 I133F probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Map1a C G 2: 121,306,408 S2568R possibly damaging Het
Mbnl1 C A 3: 60,625,172 Q301K probably damaging Het
Med12l A T 3: 59,093,617 K724N probably damaging Het
Mroh2a A C 1: 88,241,618 I672L probably benign Het
Mybph C T 1: 134,193,636 P45S probably benign Het
Myo15 T A 11: 60,501,701 S2157T probably damaging Het
Olfr113 G T 17: 37,575,273 T50K probably damaging Het
Olfr193 T C 16: 59,110,604 E2G probably benign Het
Olfr374 T C 8: 72,109,779 V71A probably benign Het
Olfr721-ps1 T A 14: 14,407,880 Y217* probably null Het
Otogl A G 10: 107,798,357 I1419T possibly damaging Het
Ovol1 A T 19: 5,551,639 F118L probably damaging Het
Pak7 T C 2: 136,116,760 D136G probably damaging Het
Pik3r2 T C 8: 70,770,606 Y417C probably damaging Het
Ppp2r2a T C 14: 67,016,603 N372S probably benign Het
Prss30 G T 17: 23,972,832 N238K possibly damaging Het
Prss33 C A 17: 23,834,811 probably null Het
Ptpn4 T C 1: 119,765,058 E187G probably damaging Het
Ptprg A T 14: 12,207,357 N100I probably damaging Het
Rbpms2 T C 9: 65,651,042 V130A probably benign Het
Rdh7 A T 10: 127,888,612 M1K probably null Het
Rtp3 A C 9: 110,986,683 S205A probably benign Het
Ryr3 G T 2: 112,709,273 D3207E probably damaging Het
Scn9a T A 2: 66,483,459 T1972S probably benign Het
Scnn1b T C 7: 121,902,328 V122A probably benign Het
Slc15a4 A G 5: 127,608,979 L213S probably damaging Het
Slc27a5 T A 7: 12,991,246 I425F probably damaging Het
Spata31d1b A G 13: 59,716,628 D530G probably benign Het
Tcf25 T A 8: 123,381,550 S115T probably benign Het
Tet2 A G 3: 133,466,852 L1883P possibly damaging Het
Trim21 T A 7: 102,561,898 R205* probably null Het
Ttc23 G T 7: 67,725,321 probably null Het
Unc13d T C 11: 116,068,673 K658R probably null Het
Vmn1r43 A G 6: 89,869,590 F305L possibly damaging Het
Vmn2r2 A T 3: 64,117,130 C677S probably benign Het
Wnt5a T C 14: 28,518,343 M150T probably benign Het
Ythdc1 G A 5: 86,828,122 probably null Het
Zcchc6 T C 13: 59,799,903 E466G possibly damaging Het
Zdbf2 A T 1: 63,304,249 R596* probably null Het
Other mutations in Btd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01125:Btd APN 14 31667776 missense probably benign 0.00
IGL02728:Btd APN 14 31667362 missense probably benign 0.00
IGL02965:Btd APN 14 31667236 missense probably damaging 1.00
R1503:Btd UTSW 14 31667655 missense probably damaging 1.00
R1817:Btd UTSW 14 31662289 missense possibly damaging 0.95
R1868:Btd UTSW 14 31667309 missense probably benign 0.13
R2225:Btd UTSW 14 31667060 missense probably benign 0.00
R2418:Btd UTSW 14 31641136 critical splice donor site probably null
R4660:Btd UTSW 14 31667803 missense probably benign 0.00
R4727:Btd UTSW 14 31662321 missense probably benign 0.01
R4923:Btd UTSW 14 31662087 missense possibly damaging 0.92
R5703:Btd UTSW 14 31667047 nonsense probably null
R5806:Btd UTSW 14 31667512 missense probably benign
R6110:Btd UTSW 14 31641108 unclassified probably benign
R6119:Btd UTSW 14 31641108 unclassified probably benign
R6120:Btd UTSW 14 31641108 unclassified probably benign
R7019:Btd UTSW 14 31667105 missense probably damaging 1.00
R7019:Btd UTSW 14 31667106 missense possibly damaging 0.88
R7021:Btd UTSW 14 31667831 missense probably benign
Predicted Primers PCR Primer
(F):5'- CACAGACCTATGAGAGCTGCTTACG -3'
(R):5'- GATGTCAAAGCAAGTGAACACGCC -3'

Sequencing Primer
(F):5'- tgagagctgcttacgtattatagac -3'
(R):5'- TGATGAGGTCCACGTTAGCAG -3'
Posted On2014-05-09