Mutagenetix > Incidental Mutations

Incidental Mutation 'R1662:Epas1'

186887

Institutional Source

Beutler Lab

Gene Symbol

Epas1

Ensembl Gene

ENSMUSG00000024140

Gene Name

endothelial PAS domain protein 1

Synonyms

HIF-2alpha, HRF, HLF, bHLHe73, hypoxia inducible transcription factor 2alpha, HIF2A, MOP2, Hif like protein

MMRRC Submission

039698-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1662 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

86753907-86833410 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 86829027 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 742 (K742N)

Ref Sequence

ENSEMBL: ENSMUSP00000024954 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024954]

AlphaFold

P97481

Predicted Effect

probably damaging
Transcript: ENSMUST00000024954
AA Change: K742N

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000024954
Gene: ENSMUSG00000024140
AA Change: K742N

Domain	Start	End	E-Value	Type
HLH	20	75	3.98e-9	SMART
PAS	86	152	6.39e-9	SMART
PAS	232	298	6.75e-8	SMART
PAC	304	347	5.56e-9	SMART
low complexity region	464	484	N/A	INTRINSIC
Pfam:HIF-1	516	548	4.9e-21	PFAM
low complexity region	725	737	N/A	INTRINSIC
low complexity region	775	796	N/A	INTRINSIC
Pfam:HIF-1a_CTAD	837	873	3.6e-23	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.2%
20x: 92.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor involved in the induction of genes regulated by oxygen, which is induced as oxygen levels fall. The encoded protein contains a basic-helix-loop-helix domain protein dimerization domain as well as a domain found in proteins in signal transduction pathways which respond to oxygen levels. Mutations in this gene are associated with erythrocytosis familial type 4. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for null mutations display prenatal, neonatal or postnatal lethality. For some alleles lethality is associated with vascular abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730409E04Rik	T	A	4: 126,611,682	M1K	probably null	Het
5730507C01Rik	A	C	12: 18,531,966	R119S	possibly damaging	Het
Abca1	T	A	4: 53,090,251		probably null	Het
Aff1	G	A	5: 103,841,057	G830D	probably damaging	Het
AI987944	T	C	7: 41,374,449	T369A	possibly damaging	Het
Aoah	A	G	13: 21,000,113		probably null	Het
Arhgap40	C	G	2: 158,539,270	C349W	probably damaging	Het
Atic	T	A	1: 71,576,127	D438E	probably benign	Het
Barhl2	A	T	5: 106,453,499	M338K	probably benign	Het
Btd	T	C	14: 31,666,790	V156A	probably damaging	Het
Ccdc82	T	C	9: 13,262,772	V319A	probably damaging	Het
Celsr1	G	T	15: 86,031,062	N903K	probably damaging	Het
Cenpf	T	A	1: 189,657,771	N1288I	probably damaging	Het
Ciao1	G	A	2: 127,244,937	T252I	probably benign	Het
Cma2	T	C	14: 55,973,116	C87R	probably damaging	Het
Cops7a	T	A	6: 124,962,438	R83W	probably damaging	Het
Cxcr6	A	T	9: 123,810,548	M205L	possibly damaging	Het
Dcc	A	G	18: 71,420,338	L749P	probably benign	Het
Dync1i2	C	T	2: 71,250,979	T484I	possibly damaging	Het
Evc2	A	G	5: 37,348,750	T138A	probably benign	Het
F5	T	C	1: 164,207,888	I1877T	probably damaging	Het
Fat1	T	G	8: 44,953,164	V984G	probably benign	Het
Fat4	T	A	3: 38,980,779	V2860D	probably damaging	Het
Foxn4	C	T	5: 114,256,894	R324Q	probably benign	Het
Gapdhs	C	T	7: 30,737,002	R120H	probably damaging	Het
Gcnt3	T	C	9: 70,034,377	D303G	probably benign	Het
Gm16432	A	G	1: 178,046,986	K140E	unknown	Het
Gng11	A	T	6: 4,008,066	Y43F	probably benign	Het
Hectd4	A	C	5: 121,317,245	M651L	probably benign	Het
Ifngr2	T	A	16: 91,560,596	Y200N	probably benign	Het
Iqgap3	T	C	3: 88,098,401	V512A	probably benign	Het
Kdm2a	A	C	19: 4,328,212	D187E	probably damaging	Het
Klhl8	A	G	5: 103,872,045	V370A	probably damaging	Het
Kmt2a	G	A	9: 44,836,670		probably benign	Het
Krt12	C	A	11: 99,420,824	V184F	probably benign	Het
Lrrc8c	A	T	5: 105,606,757	I133F	probably benign	Het
Lsmem1	GTACATACATACATACATACATACATACA	GTACATACATACATACATACATACATACATACA	12: 40,185,261		probably null	Het
Map1a	C	G	2: 121,306,408	S2568R	possibly damaging	Het
Mbnl1	C	A	3: 60,625,172	Q301K	probably damaging	Het
Med12l	A	T	3: 59,093,617	K724N	probably damaging	Het
Mroh2a	A	C	1: 88,241,618	I672L	probably benign	Het
Mybph	C	T	1: 134,193,636	P45S	probably benign	Het
Myo15	T	A	11: 60,501,701	S2157T	probably damaging	Het
Olfr113	G	T	17: 37,575,273	T50K	probably damaging	Het
Olfr193	T	C	16: 59,110,604	E2G	probably benign	Het
Olfr374	T	C	8: 72,109,779	V71A	probably benign	Het
Olfr721-ps1	T	A	14: 14,407,880	Y217*	probably null	Het
Otogl	A	G	10: 107,798,357	I1419T	possibly damaging	Het
Ovol1	A	T	19: 5,551,639	F118L	probably damaging	Het
Pak7	T	C	2: 136,116,760	D136G	probably damaging	Het
Pik3r2	T	C	8: 70,770,606	Y417C	probably damaging	Het
Ppp2r2a	T	C	14: 67,016,603	N372S	probably benign	Het
Prss30	G	T	17: 23,972,832	N238K	possibly damaging	Het
Prss33	C	A	17: 23,834,811		probably null	Het
Ptpn4	T	C	1: 119,765,058	E187G	probably damaging	Het
Ptprg	A	T	14: 12,207,357	N100I	probably damaging	Het
Rbpms2	T	C	9: 65,651,042	V130A	probably benign	Het
Rdh7	A	T	10: 127,888,612	M1K	probably null	Het
Rtp3	A	C	9: 110,986,683	S205A	probably benign	Het
Ryr3	G	T	2: 112,709,273	D3207E	probably damaging	Het
Scn9a	T	A	2: 66,483,459	T1972S	probably benign	Het
Scnn1b	T	C	7: 121,902,328	V122A	probably benign	Het
Slc15a4	A	G	5: 127,608,979	L213S	probably damaging	Het
Slc27a5	T	A	7: 12,991,246	I425F	probably damaging	Het
Spata31d1b	A	G	13: 59,716,628	D530G	probably benign	Het
Tcf25	T	A	8: 123,381,550	S115T	probably benign	Het
Tet2	A	G	3: 133,466,852	L1883P	possibly damaging	Het
Trim21	T	A	7: 102,561,898	R205*	probably null	Het
Ttc23	G	T	7: 67,725,321		probably null	Het
Unc13d	T	C	11: 116,068,673	K658R	probably null	Het
Vmn1r43	A	G	6: 89,869,590	F305L	possibly damaging	Het
Vmn2r2	A	T	3: 64,117,130	C677S	probably benign	Het
Wnt5a	T	C	14: 28,518,343	M150T	probably benign	Het
Ythdc1	G	A	5: 86,828,122		probably null	Het
Zcchc6	T	C	13: 59,799,903	E466G	possibly damaging	Het
Zdbf2	A	T	1: 63,304,249	R596*	probably null	Het

Other mutations in Epas1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01934:Epas1	APN	17	86823729	missense	probably damaging	1.00
IGL02150:Epas1	APN	17	86805289	missense	probably damaging	1.00
IGL02221:Epas1	APN	17	86827847	missense	possibly damaging	0.50
IGL02555:Epas1	APN	17	86829064	missense	probably benign
IGL02739:Epas1	APN	17	86805282	missense	probably damaging	0.98
IGL03389:Epas1	APN	17	86823703	missense	probably benign	0.10
R0043:Epas1	UTSW	17	86823812	missense	probably damaging	0.99
R0363:Epas1	UTSW	17	86805848	splice site	probably benign
R0399:Epas1	UTSW	17	86805193	missense	probably benign	0.01
R0737:Epas1	UTSW	17	86829456	missense	possibly damaging	0.45
R1542:Epas1	UTSW	17	86824490	missense	possibly damaging	0.67
R1885:Epas1	UTSW	17	86805295	missense	probably damaging	1.00
R2197:Epas1	UTSW	17	86829043	missense	probably benign	0.01
R3056:Epas1	UTSW	17	86830981	missense	probably damaging	0.99
R4342:Epas1	UTSW	17	86823800	missense	probably damaging	1.00
R4391:Epas1	UTSW	17	86809663	missense	probably benign	0.00
R4774:Epas1	UTSW	17	86805758	missense	probably damaging	1.00
R4798:Epas1	UTSW	17	86805839	missense	probably benign
R4989:Epas1	UTSW	17	86809454	missense	probably damaging	1.00
R5133:Epas1	UTSW	17	86809454	missense	probably damaging	1.00
R5604:Epas1	UTSW	17	86805772	missense	probably damaging	1.00
R5811:Epas1	UTSW	17	86823775	missense	probably damaging	1.00
R5838:Epas1	UTSW	17	86823686	missense	possibly damaging	0.94
R5885:Epas1	UTSW	17	86827544	missense	probably damaging	1.00
R5932:Epas1	UTSW	17	86827646	missense	possibly damaging	0.66
R6045:Epas1	UTSW	17	86809399	missense	probably damaging	0.99
R6145:Epas1	UTSW	17	86829429	missense	probably benign	0.01
R7517:Epas1	UTSW	17	86831098	missense	possibly damaging	0.92
R7552:Epas1	UTSW	17	86829043	missense	probably benign	0.01
R7828:Epas1	UTSW	17	86827699	missense	probably benign	0.04
R8081:Epas1	UTSW	17	86829369	missense	probably benign
R8111:Epas1	UTSW	17	86818432	nonsense	probably null
R8558:Epas1	UTSW	17	86809468	missense	possibly damaging	0.89
R8948:Epas1	UTSW	17	86827492	missense	probably benign	0.01
R9074:Epas1	UTSW	17	86827839	missense	probably benign	0.41
R9204:Epas1	UTSW	17	86809445	missense	probably damaging	1.00
R9228:Epas1	UTSW	17	86826562	missense	possibly damaging	0.71
R9319:Epas1	UTSW	17	86797117	missense	possibly damaging	0.88
Z1176:Epas1	UTSW	17	86827946	missense	possibly damaging	0.53

Predicted Primers

PCR Primer
(F):5'- TGAGGAGCAAGCCTTCCAAGACAC -3'
(R):5'- CCTGCTCATGGCATGGATATAACCC -3'

Sequencing Primer
(F):5'- TGTCTGTGAACGAACAGCC -3'
(R):5'- CCATTCTAACAAGGCTCAGGG -3'

Posted On

2014-05-09