Mutagenetix > Incidental Mutations

Incidental Mutation 'R1663:Setx'

186897

Institutional Source

Beutler Lab

Gene Symbol

Setx

Ensembl Gene

ENSMUSG00000043535

Gene Name

senataxin

Synonyms

A930037J23Rik, Als4

MMRRC Submission

039699-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1663 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

29124181-29182471 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 29126905 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 7 (C7S)

Ref Sequence

ENSEMBL: ENSMUSP00000119521 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061578] [ENSMUST00000129544]

AlphaFold

A2AKX3

Predicted Effect

probably damaging
Transcript: ENSMUST00000061578
AA Change: C7S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000051492
Gene: ENSMUSG00000043535
AA Change: C7S

Domain	Start	End	E-Value	Type
low complexity region	864	876	N/A	INTRINSIC
low complexity region	1002	1020	N/A	INTRINSIC
low complexity region	1058	1079	N/A	INTRINSIC
low complexity region	1575	1594	N/A	INTRINSIC
Pfam:AAA_11	1909	2194	1.9e-68	PFAM
Pfam:AAA_19	1924	2015	2.9e-11	PFAM
Pfam:AAA_12	2201	2402	1.1e-54	PFAM
low complexity region	2499	2516	N/A	INTRINSIC
low complexity region	2576	2587	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000129544
AA Change: C7S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154910

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein named for its homology to the Sen1p protein of fungi which has RNA helicase activity encoded by a domain at the C-terminal end of the protein. The protein encoded by this gene contains a DNA/RNA helicase domain at its C-terminal end which suggests that it may be involved in both DNA and RNA processing. Mutations in this gene have been associated with ataxia-ocular apraxia-2 (AOA2) and an autosomal dominant form of juvenile amyotrophic lateral sclerosis (ALS4). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility due to arrested male meiosis and reduced female fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam3	T	A	8: 24,687,933	T11S	probably benign	Het
Adgb	T	C	10: 10,339,675	M1529V	possibly damaging	Het
Ankrd36	T	A	11: 5,620,126	D531E	possibly damaging	Het
Ankzf1	C	T	1: 75,196,270	P337S	probably damaging	Het
Apc	A	G	18: 34,268,325	I55V	probably damaging	Het
Aplnr	A	G	2: 85,136,694	D21G	possibly damaging	Het
Apol10b	A	T	15: 77,588,714	F47I	probably damaging	Het
Arhgef5	G	A	6: 43,276,965	A1131T	probably damaging	Het
Arrb2	A	T	11: 70,437,603	Q83L	probably damaging	Het
Atf7ip	A	G	6: 136,603,324	Q1082R	possibly damaging	Het
Atl2	A	G	17: 79,864,711	S28P	probably damaging	Het
Brd7	T	C	8: 88,358,023	K89E	possibly damaging	Het
Cc2d1b	A	G	4: 108,623,547	T55A	probably damaging	Het
Ccdc18	A	G	5: 108,216,090	E1217G	probably damaging	Het
Cdc42ep4	A	T	11: 113,729,451	M38K	probably damaging	Het
Cldn14	A	G	16: 93,919,278	S227P	probably damaging	Het
Clspn	T	A	4: 126,565,975	C332S	probably benign	Het
Col5a1	T	C	2: 27,951,476	S370P	unknown	Het
Comp	T	C	8: 70,373,600	L10P	possibly damaging	Het
Dcc	A	T	18: 71,826,052	N216K	probably damaging	Het
Dcstamp	C	T	15: 39,754,944	Q250*	probably null	Het
Drd5	T	C	5: 38,320,855	F397S	probably benign	Het
Dst	T	C	1: 34,163,385	S265P	probably damaging	Het
Enam	A	T	5: 88,503,994	S1046C	probably damaging	Het
Eno3	T	C	11: 70,662,274		probably null	Het
Fam13a	G	A	6: 58,954,372	R408*	probably null	Het
Gipc2	T	A	3: 152,094,164	M310L	probably benign	Het
Gm14496	T	C	2: 181,997,437	V440A	probably benign	Het
Gzmg	A	T	14: 56,156,808	C210S	probably damaging	Het
Helb	G	T	10: 120,105,433	A450E	probably damaging	Het
Hepacam2	A	T	6: 3,483,439	I190N	possibly damaging	Het
Hk3	A	T	13: 55,006,575	S773T	probably benign	Het
Hnrnpc	A	G	14: 52,075,395	S221P	probably damaging	Het
Ifna9	T	C	4: 88,591,983	T135A	probably benign	Het
Igfn1	C	T	1: 135,968,308	G1507R	probably benign	Het
Kank3	A	G	17: 33,818,375	T218A	probably benign	Het
Kcp	G	T	6: 29,498,965	R337S	possibly damaging	Het
Krt74	A	T	15: 101,756,674		noncoding transcript	Het
Lrp1	A	T	10: 127,556,921	D2758E	probably damaging	Het
Ly75	T	C	2: 60,314,234	E1295G	probably damaging	Het
Mccc1	C	A	3: 35,978,933	W354L	probably damaging	Het
Mmp1a	C	T	9: 7,465,656	T198M	probably benign	Het
Mtmr2	C	T	9: 13,803,501	T519I	probably damaging	Het
Nbea	A	G	3: 55,645,986	S2632P	possibly damaging	Het
Nbn	T	A	4: 15,970,903	D295E	probably benign	Het
Ndufb8	T	C	19: 44,550,381	Y167C	probably damaging	Het
Nisch	A	G	14: 31,191,521		probably benign	Het
Notch3	C	T	17: 32,156,119	G407D	probably damaging	Het
Nucb1	A	G	7: 45,498,864	F175S	probably damaging	Het
Olfr355	T	G	2: 36,927,334	Y260S	probably damaging	Het
Olfr804	G	A	10: 129,705,291	V138M	probably benign	Het
Olfr834	T	A	9: 18,988,710	C241S	probably damaging	Het
Olfr907	T	G	9: 38,499,572	I301R	unknown	Het
Pip5k1c	T	C	10: 81,312,515	V425A	probably damaging	Het
Pnisr	T	A	4: 21,873,857		probably benign	Het
Prkag1	A	G	15: 98,815,895	V18A	probably damaging	Het
Rad50	T	C	11: 53,668,223	N1063S	probably benign	Het
Rnf170	C	T	8: 26,129,143	H132Y	probably damaging	Het
Rnf213	A	G	11: 119,437,672	D1977G	probably benign	Het
Sema3a	G	A	5: 13,557,125		probably null	Het
Slc23a2	A	G	2: 132,065,464	I417T	probably damaging	Het
Spink6	T	G	18: 44,071,521	F18C	unknown	Het
Sptbn1	T	C	11: 30,120,783	Q1538R	possibly damaging	Het
Strn3	A	G	12: 51,652,826	Y188H	probably damaging	Het
Tecpr1	C	A	5: 144,197,944	K1040N	probably benign	Het
Tll1	T	A	8: 64,017,686	Y901F	probably benign	Het
Tmem81	C	T	1: 132,507,897	A147V	probably benign	Het
Tnpo3	T	C	6: 29,565,759	D532G	probably benign	Het
Vmn2r19	T	A	6: 123,336,452	I827N	probably benign	Het
Wdr35	A	G	12: 9,020,000	K857R	probably benign	Het
Wdr60	T	C	12: 116,229,610	Q574R	probably benign	Het
Zfp110	A	G	7: 12,848,642	T406A	probably benign	Het
Zfp52	T	C	17: 21,561,822	L644P	possibly damaging	Het
Zfp605	G	A	5: 110,127,585	V190I	probably benign	Het
Zfp964	A	G	8: 69,664,083		probably null	Het
Zmynd8	A	G	2: 165,807,885	S779P	probably benign	Het
Zswim5	T	A	4: 116,986,895	N1043K	probably damaging	Het

Other mutations in Setx

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00688:Setx	APN	2	29148445	missense	possibly damaging	0.50
IGL00806:Setx	APN	2	29127026	missense	probably damaging	1.00
IGL01346:Setx	APN	2	29144809	missense	probably damaging	1.00
IGL01623:Setx	APN	2	29163009	missense	possibly damaging	0.70
IGL02351:Setx	APN	2	29146964	missense	probably benign	0.45
IGL02358:Setx	APN	2	29146964	missense	probably benign	0.45
IGL02378:Setx	APN	2	29173726	splice site	probably benign
IGL02388:Setx	APN	2	29173653	missense	probably damaging	1.00
IGL02408:Setx	APN	2	29133930	missense	probably damaging	1.00
IGL02425:Setx	APN	2	29148408	missense	probably benign	0.00
IGL03023:Setx	APN	2	29145902	missense	probably benign	0.02
IGL03351:Setx	APN	2	29161799	missense	probably benign	0.25
Addison	UTSW	2	29158905	missense	probably damaging	1.00
dallas	UTSW	2	29154061	frame shift	probably null
Denton	UTSW	2	29145060	missense	possibly damaging	0.81
doggie	UTSW	2	29164550	missense	probably damaging	1.00
Irving	UTSW	2	29139221	missense	probably damaging	0.99
G1Funyon:Setx	UTSW	2	29145690	missense	possibly damaging	0.69
IGL03014:Setx	UTSW	2	29139411	missense	probably damaging	1.00
PIT4403001:Setx	UTSW	2	29133955	missense	probably damaging	1.00
R0027:Setx	UTSW	2	29139221	missense	probably damaging	0.99
R0031:Setx	UTSW	2	29176929	missense	probably benign	0.02
R0070:Setx	UTSW	2	29161525	missense	probably benign	0.00
R0070:Setx	UTSW	2	29161525	missense	probably benign	0.00
R0092:Setx	UTSW	2	29146293	missense	probably benign	0.00
R0193:Setx	UTSW	2	29179673	missense	probably benign	0.21
R0281:Setx	UTSW	2	29179643	missense	probably benign	0.00
R0401:Setx	UTSW	2	29166289	nonsense	probably null
R0413:Setx	UTSW	2	29139278	missense	probably damaging	1.00
R0517:Setx	UTSW	2	29157133	missense	probably benign	0.00
R0536:Setx	UTSW	2	29158248	missense	possibly damaging	0.46
R0617:Setx	UTSW	2	29146807	missense	possibly damaging	0.86
R1183:Setx	UTSW	2	29180092	missense	probably benign
R1331:Setx	UTSW	2	29179686	missense	probably benign
R1465:Setx	UTSW	2	29140389	critical splice donor site	probably null
R1465:Setx	UTSW	2	29140389	critical splice donor site	probably null
R1467:Setx	UTSW	2	29158905	missense	probably damaging	1.00
R1467:Setx	UTSW	2	29158905	missense	probably damaging	1.00
R1482:Setx	UTSW	2	29162992	missense	probably damaging	0.99
R1599:Setx	UTSW	2	29140373	missense	probably benign	0.04
R1909:Setx	UTSW	2	29163009	missense	possibly damaging	0.70
R2117:Setx	UTSW	2	29130301	missense	probably benign	0.01
R2207:Setx	UTSW	2	29154061	frame shift	probably null
R2221:Setx	UTSW	2	29154061	frame shift	probably null
R2223:Setx	UTSW	2	29148537	missense	possibly damaging	0.89
R2223:Setx	UTSW	2	29154061	frame shift	probably null
R2273:Setx	UTSW	2	29154061	frame shift	probably null
R2274:Setx	UTSW	2	29154061	frame shift	probably null
R2275:Setx	UTSW	2	29154061	frame shift	probably null
R2309:Setx	UTSW	2	29158904	missense	probably damaging	1.00
R2328:Setx	UTSW	2	29154060	frame shift	probably null
R2328:Setx	UTSW	2	29154061	frame shift	probably null
R2329:Setx	UTSW	2	29154061	frame shift	probably null
R2331:Setx	UTSW	2	29154061	frame shift	probably null
R2332:Setx	UTSW	2	29154061	frame shift	probably null
R2429:Setx	UTSW	2	29179898	missense	probably benign	0.00
R2438:Setx	UTSW	2	29154061	frame shift	probably null
R2439:Setx	UTSW	2	29154061	frame shift	probably null
R2496:Setx	UTSW	2	29144801	missense	probably benign	0.11
R2858:Setx	UTSW	2	29154061	frame shift	probably null
R2859:Setx	UTSW	2	29154061	frame shift	probably null
R2884:Setx	UTSW	2	29148625	missense	probably damaging	0.98
R2885:Setx	UTSW	2	29148625	missense	probably damaging	0.98
R2886:Setx	UTSW	2	29148625	missense	probably damaging	0.98
R2915:Setx	UTSW	2	29172324	missense	probably damaging	0.99
R2921:Setx	UTSW	2	29154060	small deletion	probably benign
R2921:Setx	UTSW	2	29154061	frame shift	probably null
R2923:Setx	UTSW	2	29154061	frame shift	probably null
R3426:Setx	UTSW	2	29154061	frame shift	probably null
R3609:Setx	UTSW	2	29154061	frame shift	probably null
R3610:Setx	UTSW	2	29154061	frame shift	probably null
R3731:Setx	UTSW	2	29154061	frame shift	probably null
R3813:Setx	UTSW	2	29154061	frame shift	probably null
R3835:Setx	UTSW	2	29145060	missense	possibly damaging	0.81
R3871:Setx	UTSW	2	29145741	missense	probably damaging	0.98
R4013:Setx	UTSW	2	29154061	frame shift	probably null
R4014:Setx	UTSW	2	29154061	frame shift	probably null
R4015:Setx	UTSW	2	29154061	frame shift	probably null
R4017:Setx	UTSW	2	29154061	frame shift	probably null
R4246:Setx	UTSW	2	29154061	frame shift	probably null
R4248:Setx	UTSW	2	29154061	frame shift	probably null
R4297:Setx	UTSW	2	29154061	frame shift	probably null
R4298:Setx	UTSW	2	29154061	frame shift	probably null
R4539:Setx	UTSW	2	29179748	missense	probably benign	0.14
R4590:Setx	UTSW	2	29144809	missense	probably damaging	1.00
R4632:Setx	UTSW	2	29148615	missense	probably benign	0.23
R4782:Setx	UTSW	2	29144046	missense	probably damaging	0.99
R4801:Setx	UTSW	2	29146373	missense	probably benign	0.14
R4802:Setx	UTSW	2	29146373	missense	probably benign	0.14
R4975:Setx	UTSW	2	29164550	missense	probably damaging	1.00
R5040:Setx	UTSW	2	29139338	missense	probably damaging	1.00
R5133:Setx	UTSW	2	29180081	missense	probably benign	0.02
R5208:Setx	UTSW	2	29166367	missense	possibly damaging	0.63
R5237:Setx	UTSW	2	29146983	missense	probably benign	0.00
R5248:Setx	UTSW	2	29148418	missense	probably benign	0.26
R5288:Setx	UTSW	2	29134033	critical splice donor site	probably null
R5385:Setx	UTSW	2	29134033	critical splice donor site	probably null
R5387:Setx	UTSW	2	29147594	missense	probably benign	0.00
R5407:Setx	UTSW	2	29145474	missense	probably benign	0.00
R5685:Setx	UTSW	2	29171280	missense	probably damaging	1.00
R6110:Setx	UTSW	2	29140290	missense	probably damaging	1.00
R6136:Setx	UTSW	2	29148027	missense	probably benign	0.01
R6310:Setx	UTSW	2	29176935	missense	possibly damaging	0.57
R6328:Setx	UTSW	2	29174462	intron	probably benign
R6358:Setx	UTSW	2	29171348	missense	possibly damaging	0.79
R6384:Setx	UTSW	2	29173558	missense	probably damaging	1.00
R6400:Setx	UTSW	2	29130274	missense	probably damaging	0.97
R6572:Setx	UTSW	2	29173694	missense	possibly damaging	0.63
R6662:Setx	UTSW	2	29158114	missense	probably damaging	0.97
R6898:Setx	UTSW	2	29148108	missense	probably benign	0.00
R7188:Setx	UTSW	2	29148172	missense	probably benign	0.02
R7332:Setx	UTSW	2	29146626	missense	probably benign	0.00
R7357:Setx	UTSW	2	29130301	missense	probably benign	0.01
R7556:Setx	UTSW	2	29146493	missense	possibly damaging	0.88
R7646:Setx	UTSW	2	29177549	missense	possibly damaging	0.94
R7802:Setx	UTSW	2	29147021	missense	probably benign	0.02
R7810:Setx	UTSW	2	29148651	missense	probably benign	0.43
R7831:Setx	UTSW	2	29157108	missense	probably damaging	1.00
R7831:Setx	UTSW	2	29179854	missense	possibly damaging	0.75
R7843:Setx	UTSW	2	29173569	missense	probably damaging	1.00
R7850:Setx	UTSW	2	29147418	missense	probably damaging	1.00
R7858:Setx	UTSW	2	29161550	missense	probably damaging	1.00
R8121:Setx	UTSW	2	29145034	missense	possibly damaging	0.93
R8284:Setx	UTSW	2	29145336	missense	possibly damaging	0.46
R8301:Setx	UTSW	2	29145690	missense	possibly damaging	0.69
R8752:Setx	UTSW	2	29158980	missense	probably damaging	0.97
R8785:Setx	UTSW	2	29145263	missense	probably damaging	1.00
R8871:Setx	UTSW	2	29148102	missense	probably benign	0.11
R8927:Setx	UTSW	2	29126959	missense	possibly damaging	0.59
R8928:Setx	UTSW	2	29126959	missense	possibly damaging	0.59
R9182:Setx	UTSW	2	29171287	missense	probably damaging	1.00
R9334:Setx	UTSW	2	29154020	nonsense	probably null
R9335:Setx	UTSW	2	29145951	missense	probably benign	0.00
X0066:Setx	UTSW	2	29147879	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGTCAGCACTCTCAATGGAGCAC -3'
(R):5'- TGCAAGAACGGCACCTCATCTC -3'

Sequencing Primer
(F):5'- gcatctctccagcccatac -3'
(R):5'- CTCTGGCTCGGTGGTACTC -3'

Posted On

2014-05-09