Incidental Mutation 'R1663:Tnpo3'
ID186925
Institutional Source Beutler Lab
Gene Symbol Tnpo3
Ensembl Gene ENSMUSG00000012535
Gene Nametransportin 3
SynonymsD6Ertd313e, 5730544L10Rik, C430013M08Rik
MMRRC Submission 039699-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1663 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location29540827-29609887 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29565759 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 532 (D532G)
Ref Sequence ENSEMBL: ENSMUSP00000110906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012679] [ENSMUST00000115251] [ENSMUST00000170350]
Predicted Effect probably benign
Transcript: ENSMUST00000012679
AA Change: D532G

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000012679
Gene: ENSMUSG00000012535
AA Change: D532G

DomainStartEndE-ValueType
Blast:IBN_N 30 96 6e-35 BLAST
Pfam:Xpo1 101 249 3.5e-30 PFAM
low complexity region 318 328 N/A INTRINSIC
low complexity region 823 838 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115251
AA Change: D532G

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000110906
Gene: ENSMUSG00000012535
AA Change: D532G

DomainStartEndE-ValueType
Blast:IBN_N 30 96 6e-35 BLAST
Pfam:Xpo1 101 249 3e-30 PFAM
low complexity region 318 328 N/A INTRINSIC
low complexity region 829 844 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169302
Predicted Effect probably benign
Transcript: ENSMUST00000170350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201797
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear import receptor for serine/arginine-rich (SR) proteins such as the splicing factors SFRS1 and SFRS2. The encoded protein has also been shown to be involved in HIV-1 infection, apparently through interaction with the HIV-1 capsid protein. Two transcript variants encoding different isoforms as well as a noncoding transcript have been found for this gene.[provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T A 8: 24,687,933 T11S probably benign Het
Adgb T C 10: 10,339,675 M1529V possibly damaging Het
Ankrd36 T A 11: 5,620,126 D531E possibly damaging Het
Ankzf1 C T 1: 75,196,270 P337S probably damaging Het
Apc A G 18: 34,268,325 I55V probably damaging Het
Aplnr A G 2: 85,136,694 D21G possibly damaging Het
Apol10b A T 15: 77,588,714 F47I probably damaging Het
Arhgef5 G A 6: 43,276,965 A1131T probably damaging Het
Arrb2 A T 11: 70,437,603 Q83L probably damaging Het
Atf7ip A G 6: 136,603,324 Q1082R possibly damaging Het
Atl2 A G 17: 79,864,711 S28P probably damaging Het
Brd7 T C 8: 88,358,023 K89E possibly damaging Het
Cc2d1b A G 4: 108,623,547 T55A probably damaging Het
Ccdc18 A G 5: 108,216,090 E1217G probably damaging Het
Cdc42ep4 A T 11: 113,729,451 M38K probably damaging Het
Cldn14 A G 16: 93,919,278 S227P probably damaging Het
Clspn T A 4: 126,565,975 C332S probably benign Het
Col5a1 T C 2: 27,951,476 S370P unknown Het
Comp T C 8: 70,373,600 L10P possibly damaging Het
Dcc A T 18: 71,826,052 N216K probably damaging Het
Dcstamp C T 15: 39,754,944 Q250* probably null Het
Drd5 T C 5: 38,320,855 F397S probably benign Het
Dst T C 1: 34,163,385 S265P probably damaging Het
Enam A T 5: 88,503,994 S1046C probably damaging Het
Eno3 T C 11: 70,662,274 probably null Het
Fam13a G A 6: 58,954,372 R408* probably null Het
Gipc2 T A 3: 152,094,164 M310L probably benign Het
Gm14496 T C 2: 181,997,437 V440A probably benign Het
Gzmg A T 14: 56,156,808 C210S probably damaging Het
Helb G T 10: 120,105,433 A450E probably damaging Het
Hepacam2 A T 6: 3,483,439 I190N possibly damaging Het
Hk3 A T 13: 55,006,575 S773T probably benign Het
Hnrnpc A G 14: 52,075,395 S221P probably damaging Het
Ifna9 T C 4: 88,591,983 T135A probably benign Het
Igfn1 C T 1: 135,968,308 G1507R probably benign Het
Kank3 A G 17: 33,818,375 T218A probably benign Het
Kcp G T 6: 29,498,965 R337S possibly damaging Het
Krt74 A T 15: 101,756,674 noncoding transcript Het
Lrp1 A T 10: 127,556,921 D2758E probably damaging Het
Ly75 T C 2: 60,314,234 E1295G probably damaging Het
Mccc1 C A 3: 35,978,933 W354L probably damaging Het
Mmp1a C T 9: 7,465,656 T198M probably benign Het
Mtmr2 C T 9: 13,803,501 T519I probably damaging Het
Nbea A G 3: 55,645,986 S2632P possibly damaging Het
Nbn T A 4: 15,970,903 D295E probably benign Het
Ndufb8 T C 19: 44,550,381 Y167C probably damaging Het
Nisch A G 14: 31,191,521 probably benign Het
Notch3 C T 17: 32,156,119 G407D probably damaging Het
Nucb1 A G 7: 45,498,864 F175S probably damaging Het
Olfr355 T G 2: 36,927,334 Y260S probably damaging Het
Olfr804 G A 10: 129,705,291 V138M probably benign Het
Olfr834 T A 9: 18,988,710 C241S probably damaging Het
Olfr907 T G 9: 38,499,572 I301R unknown Het
Pip5k1c T C 10: 81,312,515 V425A probably damaging Het
Pnisr T A 4: 21,873,857 probably benign Het
Prkag1 A G 15: 98,815,895 V18A probably damaging Het
Rad50 T C 11: 53,668,223 N1063S probably benign Het
Rnf170 C T 8: 26,129,143 H132Y probably damaging Het
Rnf213 A G 11: 119,437,672 D1977G probably benign Het
Sema3a G A 5: 13,557,125 probably null Het
Setx T A 2: 29,126,905 C7S probably damaging Het
Slc23a2 A G 2: 132,065,464 I417T probably damaging Het
Spink6 T G 18: 44,071,521 F18C unknown Het
Sptbn1 T C 11: 30,120,783 Q1538R possibly damaging Het
Strn3 A G 12: 51,652,826 Y188H probably damaging Het
Tecpr1 C A 5: 144,197,944 K1040N probably benign Het
Tll1 T A 8: 64,017,686 Y901F probably benign Het
Tmem81 C T 1: 132,507,897 A147V probably benign Het
Vmn2r19 T A 6: 123,336,452 I827N probably benign Het
Wdr35 A G 12: 9,020,000 K857R probably benign Het
Wdr60 T C 12: 116,229,610 Q574R probably benign Het
Zfp110 A G 7: 12,848,642 T406A probably benign Het
Zfp52 T C 17: 21,561,822 L644P possibly damaging Het
Zfp605 G A 5: 110,127,585 V190I probably benign Het
Zfp964 A G 8: 69,664,083 probably null Het
Zmynd8 A G 2: 165,807,885 S779P probably benign Het
Zswim5 T A 4: 116,986,895 N1043K probably damaging Het
Other mutations in Tnpo3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Tnpo3 APN 6 29578461 critical splice donor site probably null
IGL00662:Tnpo3 APN 6 29565846 nonsense probably null
IGL00753:Tnpo3 APN 6 29565787 missense probably benign 0.32
IGL00906:Tnpo3 APN 6 29589048 missense probably damaging 0.99
IGL01311:Tnpo3 APN 6 29586078 missense possibly damaging 0.53
IGL01934:Tnpo3 APN 6 29575020 missense probably benign 0.14
IGL01959:Tnpo3 APN 6 29589020 splice site probably benign
IGL01987:Tnpo3 APN 6 29560201 missense probably benign 0.02
IGL02137:Tnpo3 APN 6 29609451 missense probably damaging 1.00
IGL02645:Tnpo3 APN 6 29562900 nonsense probably null
IGL03409:Tnpo3 APN 6 29555182 missense probably damaging 1.00
PIT4520001:Tnpo3 UTSW 6 29555222 missense possibly damaging 0.60
R0012:Tnpo3 UTSW 6 29589177 missense probably damaging 0.96
R0012:Tnpo3 UTSW 6 29589177 missense probably damaging 0.96
R0119:Tnpo3 UTSW 6 29568922 missense possibly damaging 0.91
R0143:Tnpo3 UTSW 6 29565652 splice site probably benign
R0384:Tnpo3 UTSW 6 29582164 critical splice donor site probably null
R0597:Tnpo3 UTSW 6 29578565 nonsense probably null
R0710:Tnpo3 UTSW 6 29586075 missense possibly damaging 0.84
R0883:Tnpo3 UTSW 6 29554993 splice site probably benign
R1494:Tnpo3 UTSW 6 29557044 missense probably damaging 1.00
R1529:Tnpo3 UTSW 6 29560221 missense possibly damaging 0.70
R1816:Tnpo3 UTSW 6 29557017 missense probably benign 0.31
R2077:Tnpo3 UTSW 6 29586144 missense possibly damaging 0.94
R2113:Tnpo3 UTSW 6 29551872 missense probably benign 0.07
R2146:Tnpo3 UTSW 6 29589036 missense probably benign 0.18
R2377:Tnpo3 UTSW 6 29579619 missense probably benign 0.19
R3765:Tnpo3 UTSW 6 29579689 missense probably benign 0.00
R3766:Tnpo3 UTSW 6 29579689 missense probably benign 0.00
R4125:Tnpo3 UTSW 6 29560092 missense probably damaging 1.00
R4525:Tnpo3 UTSW 6 29561398 missense probably benign 0.02
R4786:Tnpo3 UTSW 6 29578542 missense probably benign 0.24
R4830:Tnpo3 UTSW 6 29568938 missense probably benign 0.00
R4948:Tnpo3 UTSW 6 29582260 missense probably benign 0.01
R5215:Tnpo3 UTSW 6 29582153 splice site probably benign
R5325:Tnpo3 UTSW 6 29602013 intron probably benign
R5512:Tnpo3 UTSW 6 29575046 missense probably damaging 1.00
R5619:Tnpo3 UTSW 6 29565198 nonsense probably null
R5689:Tnpo3 UTSW 6 29571064 missense possibly damaging 0.67
R5855:Tnpo3 UTSW 6 29589033 missense probably damaging 1.00
R6101:Tnpo3 UTSW 6 29588043 nonsense probably null
R6105:Tnpo3 UTSW 6 29588043 nonsense probably null
R6137:Tnpo3 UTSW 6 29555268 missense probably benign 0.00
R6481:Tnpo3 UTSW 6 29571101 missense possibly damaging 0.91
R6534:Tnpo3 UTSW 6 29572703 splice site probably null
R6569:Tnpo3 UTSW 6 29571066 missense possibly damaging 0.62
R6976:Tnpo3 UTSW 6 29572595 nonsense probably null
R7006:Tnpo3 UTSW 6 29589163 missense probably damaging 1.00
R7312:Tnpo3 UTSW 6 29562876 missense possibly damaging 0.47
R7365:Tnpo3 UTSW 6 29556996 missense probably damaging 1.00
R7686:Tnpo3 UTSW 6 29562900 nonsense probably null
R7898:Tnpo3 UTSW 6 29565224 missense probably benign 0.01
R7901:Tnpo3 UTSW 6 29568991 missense possibly damaging 0.83
R7981:Tnpo3 UTSW 6 29565224 missense probably benign 0.01
R7984:Tnpo3 UTSW 6 29568991 missense possibly damaging 0.83
R8003:Tnpo3 UTSW 6 29551901 missense probably benign 0.09
Z1088:Tnpo3 UTSW 6 29565843 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGACTGTGTTGCCTCTACTCCAAATCTA -3'
(R):5'- TGACACTACATCAGTAAGATCAGCTCCA -3'

Sequencing Primer
(F):5'- AGAATGTATGAACATTCCCCCCTTC -3'
(R):5'- agttctcttaaccactgagcc -3'
Posted On2014-05-09