Mutagenetix > Incidental Mutation

Incidental Mutation 'R1663:Arhgef5'

186926

Institutional Source

Beutler Lab

Gene Symbol

Arhgef5

Ensembl Gene

ENSMUSG00000033542

Gene Name

Rho guanine nucleotide exchange factor (GEF) 5

Synonyms

2210412D05Rik

MMRRC Submission

039699-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1663 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

43265582-43289320 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 43276965 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 1131 (A1131T)

Ref Sequence

ENSEMBL: ENSMUSP00000031750 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031750]

AlphaFold

E9Q7D5

Predicted Effect

probably damaging
Transcript: ENSMUST00000031750
AA Change: A1131T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: A1131T

Domain	Start	End	E-Value	Type
Pfam:ARHGEF5_35	1	477	3.1e-220	PFAM
low complexity region	509	531	N/A	INTRINSIC
low complexity region	812	825	N/A	INTRINSIC
low complexity region	827	851	N/A	INTRINSIC
RhoGEF	1162	1341	2.97e-57	SMART
PH	1375	1488	1.11e-6	SMART
SH3	1497	1554	6.39e-15	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182190

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182752

Predicted Effect

unknown
Transcript: ENSMUST00000182924
AA Change: A399T

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183094

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183227

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203387

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam3	T	A	8: 24,687,933	T11S	probably benign	Het
Adgb	T	C	10: 10,339,675	M1529V	possibly damaging	Het
Ankrd36	T	A	11: 5,620,126	D531E	possibly damaging	Het
Ankzf1	C	T	1: 75,196,270	P337S	probably damaging	Het
Apc	A	G	18: 34,268,325	I55V	probably damaging	Het
Aplnr	A	G	2: 85,136,694	D21G	possibly damaging	Het
Apol10b	A	T	15: 77,588,714	F47I	probably damaging	Het
Arrb2	A	T	11: 70,437,603	Q83L	probably damaging	Het
Atf7ip	A	G	6: 136,603,324	Q1082R	possibly damaging	Het
Atl2	A	G	17: 79,864,711	S28P	probably damaging	Het
Brd7	T	C	8: 88,358,023	K89E	possibly damaging	Het
Cc2d1b	A	G	4: 108,623,547	T55A	probably damaging	Het
Ccdc18	A	G	5: 108,216,090	E1217G	probably damaging	Het
Cdc42ep4	A	T	11: 113,729,451	M38K	probably damaging	Het
Cldn14	A	G	16: 93,919,278	S227P	probably damaging	Het
Clspn	T	A	4: 126,565,975	C332S	probably benign	Het
Col5a1	T	C	2: 27,951,476	S370P	unknown	Het
Comp	T	C	8: 70,373,600	L10P	possibly damaging	Het
Dcc	A	T	18: 71,826,052	N216K	probably damaging	Het
Dcstamp	C	T	15: 39,754,944	Q250*	probably null	Het
Drd5	T	C	5: 38,320,855	F397S	probably benign	Het
Dst	T	C	1: 34,163,385	S265P	probably damaging	Het
Enam	A	T	5: 88,503,994	S1046C	probably damaging	Het
Eno3	T	C	11: 70,662,274		probably null	Het
Fam13a	G	A	6: 58,954,372	R408*	probably null	Het
Gipc2	T	A	3: 152,094,164	M310L	probably benign	Het
Gm14496	T	C	2: 181,997,437	V440A	probably benign	Het
Gzmg	A	T	14: 56,156,808	C210S	probably damaging	Het
Helb	G	T	10: 120,105,433	A450E	probably damaging	Het
Hepacam2	A	T	6: 3,483,439	I190N	possibly damaging	Het
Hk3	A	T	13: 55,006,575	S773T	probably benign	Het
Hnrnpc	A	G	14: 52,075,395	S221P	probably damaging	Het
Ifna9	T	C	4: 88,591,983	T135A	probably benign	Het
Igfn1	C	T	1: 135,968,308	G1507R	probably benign	Het
Kank3	A	G	17: 33,818,375	T218A	probably benign	Het
Kcp	G	T	6: 29,498,965	R337S	possibly damaging	Het
Krt74	A	T	15: 101,756,674		noncoding transcript	Het
Lrp1	A	T	10: 127,556,921	D2758E	probably damaging	Het
Ly75	T	C	2: 60,314,234	E1295G	probably damaging	Het
Mccc1	C	A	3: 35,978,933	W354L	probably damaging	Het
Mmp1a	C	T	9: 7,465,656	T198M	probably benign	Het
Mtmr2	C	T	9: 13,803,501	T519I	probably damaging	Het
Nbea	A	G	3: 55,645,986	S2632P	possibly damaging	Het
Nbn	T	A	4: 15,970,903	D295E	probably benign	Het
Ndufb8	T	C	19: 44,550,381	Y167C	probably damaging	Het
Nisch	A	G	14: 31,191,521		probably benign	Het
Notch3	C	T	17: 32,156,119	G407D	probably damaging	Het
Nucb1	A	G	7: 45,498,864	F175S	probably damaging	Het
Olfr355	T	G	2: 36,927,334	Y260S	probably damaging	Het
Olfr804	G	A	10: 129,705,291	V138M	probably benign	Het
Olfr834	T	A	9: 18,988,710	C241S	probably damaging	Het
Olfr907	T	G	9: 38,499,572	I301R	unknown	Het
Pip5k1c	T	C	10: 81,312,515	V425A	probably damaging	Het
Pnisr	T	A	4: 21,873,857		probably benign	Het
Prkag1	A	G	15: 98,815,895	V18A	probably damaging	Het
Rad50	T	C	11: 53,668,223	N1063S	probably benign	Het
Rnf170	C	T	8: 26,129,143	H132Y	probably damaging	Het
Rnf213	A	G	11: 119,437,672	D1977G	probably benign	Het
Sema3a	G	A	5: 13,557,125		probably null	Het
Setx	T	A	2: 29,126,905	C7S	probably damaging	Het
Slc23a2	A	G	2: 132,065,464	I417T	probably damaging	Het
Spink6	T	G	18: 44,071,521	F18C	unknown	Het
Sptbn1	T	C	11: 30,120,783	Q1538R	possibly damaging	Het
Strn3	A	G	12: 51,652,826	Y188H	probably damaging	Het
Tecpr1	C	A	5: 144,197,944	K1040N	probably benign	Het
Tll1	T	A	8: 64,017,686	Y901F	probably benign	Het
Tmem81	C	T	1: 132,507,897	A147V	probably benign	Het
Tnpo3	T	C	6: 29,565,759	D532G	probably benign	Het
Vmn2r19	T	A	6: 123,336,452	I827N	probably benign	Het
Wdr35	A	G	12: 9,020,000	K857R	probably benign	Het
Wdr60	T	C	12: 116,229,610	Q574R	probably benign	Het
Zfp110	A	G	7: 12,848,642	T406A	probably benign	Het
Zfp52	T	C	17: 21,561,822	L644P	possibly damaging	Het
Zfp605	G	A	5: 110,127,585	V190I	probably benign	Het
Zfp964	A	G	8: 69,664,083		probably null	Het
Zmynd8	A	G	2: 165,807,885	S779P	probably benign	Het
Zswim5	T	A	4: 116,986,895	N1043K	probably damaging	Het

Other mutations in Arhgef5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Arhgef5	APN	6	43280269	nonsense	probably null
IGL01341:Arhgef5	APN	6	43283991	missense	probably damaging	1.00
IGL01576:Arhgef5	APN	6	43274028	missense	probably benign	0.38
IGL01761:Arhgef5	APN	6	43274604	missense	probably benign	0.00
IGL02104:Arhgef5	APN	6	43272411	missense	probably damaging	0.99
IGL02208:Arhgef5	APN	6	43275130	missense	probably benign	0.11
IGL02487:Arhgef5	APN	6	43283982	missense	probably damaging	1.00
IGL02650:Arhgef5	APN	6	43272935	nonsense	probably null
IGL03292:Arhgef5	APN	6	43280246	missense	probably damaging	1.00
IGL03334:Arhgef5	APN	6	43274000	missense	possibly damaging	0.47
IGL03341:Arhgef5	APN	6	43280651	missense	probably damaging	0.99
R0047:Arhgef5	UTSW	6	43265621	splice site	probably null
R0206:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0208:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0698:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1168:Arhgef5	UTSW	6	43273396	missense	probably benign	0.00
R1355:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1370:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1481:Arhgef5	UTSW	6	43274634	missense	probably damaging	0.99
R1529:Arhgef5	UTSW	6	43279515	missense	probably damaging	0.96
R1532:Arhgef5	UTSW	6	43273403	missense	probably benign
R1742:Arhgef5	UTSW	6	43280199	missense	probably damaging	1.00
R1852:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R1869:Arhgef5	UTSW	6	43288682	missense	probably damaging	1.00
R1880:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R2146:Arhgef5	UTSW	6	43283318	missense	probably damaging	1.00
R2169:Arhgef5	UTSW	6	43274420	missense	probably benign	0.11
R3412:Arhgef5	UTSW	6	43273790	missense	probably benign
R4205:Arhgef5	UTSW	6	43273832	missense	possibly damaging	0.76
R4226:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4227:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4304:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4308:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4457:Arhgef5	UTSW	6	43274093	missense	probably damaging	1.00
R4469:Arhgef5	UTSW	6	43275099	missense	probably benign
R4636:Arhgef5	UTSW	6	43274942	missense	probably benign	0.11
R4791:Arhgef5	UTSW	6	43283183	missense	probably damaging	1.00
R4818:Arhgef5	UTSW	6	43273550	missense	probably benign	0.00
R4910:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R4911:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R5127:Arhgef5	UTSW	6	43273214	missense	probably damaging	0.99
R5209:Arhgef5	UTSW	6	43273700	missense	probably benign	0.01
R5245:Arhgef5	UTSW	6	43265680	start gained	probably benign
R5251:Arhgef5	UTSW	6	43272881	missense	possibly damaging	0.76
R5513:Arhgef5	UTSW	6	43272339	missense	probably damaging	0.96
R5613:Arhgef5	UTSW	6	43274063	missense	probably benign	0.01
R5616:Arhgef5	UTSW	6	43275940	missense	probably benign	0.20
R5817:Arhgef5	UTSW	6	43275104	missense	probably benign	0.15
R6024:Arhgef5	UTSW	6	43275134	missense	probably benign	0.00
R6735:Arhgef5	UTSW	6	43275032	missense	probably benign	0.01
R6825:Arhgef5	UTSW	6	43274961	missense	probably damaging	0.99
R6831:Arhgef5	UTSW	6	43280999	missense	probably damaging	1.00
R6901:Arhgef5	UTSW	6	43273298	missense	probably benign	0.00
R6932:Arhgef5	UTSW	6	43274417	missense	possibly damaging	0.94
R6968:Arhgef5	UTSW	6	43275342	missense	probably benign	0.00
R7018:Arhgef5	UTSW	6	43288731	missense	probably damaging	1.00
R7180:Arhgef5	UTSW	6	43275208	missense	possibly damaging	0.87
R7201:Arhgef5	UTSW	6	43273232	nonsense	probably null
R7358:Arhgef5	UTSW	6	43279573	missense	probably damaging	1.00
R7359:Arhgef5	UTSW	6	43280282	missense	probably damaging	1.00
R7468:Arhgef5	UTSW	6	43280671	nonsense	probably null
R7503:Arhgef5	UTSW	6	43273999	missense	probably benign	0.15
R7699:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7700:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7737:Arhgef5	UTSW	6	43273794	missense	possibly damaging	0.84
R7847:Arhgef5	UTSW	6	43275135	nonsense	probably null
R7950:Arhgef5	UTSW	6	43273925	missense	possibly damaging	0.76
R8161:Arhgef5	UTSW	6	43283951	missense	probably damaging	1.00
R8178:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R8203:Arhgef5	UTSW	6	43280645	missense	probably damaging	1.00
R8318:Arhgef5	UTSW	6	43275999	critical splice donor site	probably null
R8857:Arhgef5	UTSW	6	43287624	missense	probably damaging	1.00
R9499:Arhgef5	UTSW	6	43284006	missense
R9610:Arhgef5	UTSW	6	43280956	missense	probably damaging	0.99
R9611:Arhgef5	UTSW	6	43280956	missense	probably damaging	0.99
R9623:Arhgef5	UTSW	6	43274802	missense	possibly damaging	0.86
R9685:Arhgef5	UTSW	6	43273593	missense	probably benign	0.11
RF023:Arhgef5	UTSW	6	43279473	missense	probably damaging	1.00
X0028:Arhgef5	UTSW	6	43273701	missense	probably benign	0.03
X0065:Arhgef5	UTSW	6	43272408	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- ACCCGTAGCCCAGCTACTTTATCAG -3'
(R):5'- AACAGATTCCAAGGCAAGGTCACTC -3'

Sequencing Primer
(F):5'- CCAGCTACTTTATCAGGAGTACAGTG -3'
(R):5'- ATGCTGGATTCTCAGAGCAC -3'

Posted On

2014-05-09