Incidental Mutation 'R1663:Mmp1a'
ID186938
Institutional Source Beutler Lab
Gene Symbol Mmp1a
Ensembl Gene ENSMUSG00000043089
Gene Namematrix metallopeptidase 1a (interstitial collagenase)
SynonymsMcol-A
MMRRC Submission 039699-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #R1663 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location7464141-7476869 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 7465656 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 198 (T198M)
Ref Sequence ENSEMBL: ENSMUSP00000034492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034492] [ENSMUST00000217651]
Predicted Effect probably benign
Transcript: ENSMUST00000034492
AA Change: T198M

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000034492
Gene: ENSMUSG00000043089
AA Change: T198M

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:PG_binding_1 25 84 8.2e-14 PFAM
ZnMc 97 259 2.99e-44 SMART
HX 281 323 8.12e-6 SMART
HX 325 369 7.81e-8 SMART
HX 374 421 5.82e-16 SMART
HX 423 463 2.18e0 SMART
Predicted Effect unknown
Transcript: ENSMUST00000217651
AA Change: R199C
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme that degrades collagens. Mice lacking the encoded protein exhibit decreased susceptibility to chemical carcinogen-induced lung tumor development and angiogenesis. This gene is located in a cluster of other matrix metalloproteinase genes on chromosome 9. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced inflammatory response following chemical induction of tumors and male mice exhibit fewer large induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T A 8: 24,687,933 T11S probably benign Het
Adgb T C 10: 10,339,675 M1529V possibly damaging Het
Ankrd36 T A 11: 5,620,126 D531E possibly damaging Het
Ankzf1 C T 1: 75,196,270 P337S probably damaging Het
Apc A G 18: 34,268,325 I55V probably damaging Het
Aplnr A G 2: 85,136,694 D21G possibly damaging Het
Apol10b A T 15: 77,588,714 F47I probably damaging Het
Arhgef5 G A 6: 43,276,965 A1131T probably damaging Het
Arrb2 A T 11: 70,437,603 Q83L probably damaging Het
Atf7ip A G 6: 136,603,324 Q1082R possibly damaging Het
Atl2 A G 17: 79,864,711 S28P probably damaging Het
Brd7 T C 8: 88,358,023 K89E possibly damaging Het
Cc2d1b A G 4: 108,623,547 T55A probably damaging Het
Ccdc18 A G 5: 108,216,090 E1217G probably damaging Het
Cdc42ep4 A T 11: 113,729,451 M38K probably damaging Het
Cldn14 A G 16: 93,919,278 S227P probably damaging Het
Clspn T A 4: 126,565,975 C332S probably benign Het
Col5a1 T C 2: 27,951,476 S370P unknown Het
Comp T C 8: 70,373,600 L10P possibly damaging Het
Dcc A T 18: 71,826,052 N216K probably damaging Het
Dcstamp C T 15: 39,754,944 Q250* probably null Het
Drd5 T C 5: 38,320,855 F397S probably benign Het
Dst T C 1: 34,163,385 S265P probably damaging Het
Enam A T 5: 88,503,994 S1046C probably damaging Het
Eno3 T C 11: 70,662,274 probably null Het
Fam13a G A 6: 58,954,372 R408* probably null Het
Gipc2 T A 3: 152,094,164 M310L probably benign Het
Gm14496 T C 2: 181,997,437 V440A probably benign Het
Gzmg A T 14: 56,156,808 C210S probably damaging Het
Helb G T 10: 120,105,433 A450E probably damaging Het
Hepacam2 A T 6: 3,483,439 I190N possibly damaging Het
Hk3 A T 13: 55,006,575 S773T probably benign Het
Hnrnpc A G 14: 52,075,395 S221P probably damaging Het
Ifna9 T C 4: 88,591,983 T135A probably benign Het
Igfn1 C T 1: 135,968,308 G1507R probably benign Het
Kank3 A G 17: 33,818,375 T218A probably benign Het
Kcp G T 6: 29,498,965 R337S possibly damaging Het
Krt74 A T 15: 101,756,674 noncoding transcript Het
Lrp1 A T 10: 127,556,921 D2758E probably damaging Het
Ly75 T C 2: 60,314,234 E1295G probably damaging Het
Mccc1 C A 3: 35,978,933 W354L probably damaging Het
Mtmr2 C T 9: 13,803,501 T519I probably damaging Het
Nbea A G 3: 55,645,986 S2632P possibly damaging Het
Nbn T A 4: 15,970,903 D295E probably benign Het
Ndufb8 T C 19: 44,550,381 Y167C probably damaging Het
Nisch A G 14: 31,191,521 probably benign Het
Notch3 C T 17: 32,156,119 G407D probably damaging Het
Nucb1 A G 7: 45,498,864 F175S probably damaging Het
Olfr355 T G 2: 36,927,334 Y260S probably damaging Het
Olfr804 G A 10: 129,705,291 V138M probably benign Het
Olfr834 T A 9: 18,988,710 C241S probably damaging Het
Olfr907 T G 9: 38,499,572 I301R unknown Het
Pip5k1c T C 10: 81,312,515 V425A probably damaging Het
Pnisr T A 4: 21,873,857 probably benign Het
Prkag1 A G 15: 98,815,895 V18A probably damaging Het
Rad50 T C 11: 53,668,223 N1063S probably benign Het
Rnf170 C T 8: 26,129,143 H132Y probably damaging Het
Rnf213 A G 11: 119,437,672 D1977G probably benign Het
Sema3a G A 5: 13,557,125 probably null Het
Setx T A 2: 29,126,905 C7S probably damaging Het
Slc23a2 A G 2: 132,065,464 I417T probably damaging Het
Spink6 T G 18: 44,071,521 F18C unknown Het
Sptbn1 T C 11: 30,120,783 Q1538R possibly damaging Het
Strn3 A G 12: 51,652,826 Y188H probably damaging Het
Tecpr1 C A 5: 144,197,944 K1040N probably benign Het
Tll1 T A 8: 64,017,686 Y901F probably benign Het
Tmem81 C T 1: 132,507,897 A147V probably benign Het
Tnpo3 T C 6: 29,565,759 D532G probably benign Het
Vmn2r19 T A 6: 123,336,452 I827N probably benign Het
Wdr35 A G 12: 9,020,000 K857R probably benign Het
Wdr60 T C 12: 116,229,610 Q574R probably benign Het
Zfp110 A G 7: 12,848,642 T406A probably benign Het
Zfp52 T C 17: 21,561,822 L644P possibly damaging Het
Zfp605 G A 5: 110,127,585 V190I probably benign Het
Zfp964 A G 8: 69,664,083 probably null Het
Zmynd8 A G 2: 165,807,885 S779P probably benign Het
Zswim5 T A 4: 116,986,895 N1043K probably damaging Het
Other mutations in Mmp1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Mmp1a APN 9 7476259 missense probably benign 0.04
IGL02179:Mmp1a APN 9 7464273 missense probably benign 0.23
IGL02738:Mmp1a APN 9 7464301 splice site probably benign
IGL02984:Mmp1a UTSW 9 7465083 makesense probably null
IGL02988:Mmp1a UTSW 9 7465083 makesense probably null
IGL02991:Mmp1a UTSW 9 7465083 makesense probably null
IGL03014:Mmp1a UTSW 9 7465083 makesense probably null
IGL03050:Mmp1a UTSW 9 7465083 makesense probably null
IGL03054:Mmp1a UTSW 9 7465083 makesense probably null
IGL03055:Mmp1a UTSW 9 7465083 makesense probably null
IGL03097:Mmp1a UTSW 9 7465083 makesense probably null
IGL03098:Mmp1a UTSW 9 7465083 makesense probably null
IGL03134:Mmp1a UTSW 9 7465083 makesense probably null
IGL03138:Mmp1a UTSW 9 7465083 makesense probably null
IGL03147:Mmp1a UTSW 9 7465083 makesense probably null
R0095:Mmp1a UTSW 9 7465620 missense possibly damaging 0.51
R0095:Mmp1a UTSW 9 7465620 missense possibly damaging 0.51
R1422:Mmp1a UTSW 9 7464298 splice site probably null
R1801:Mmp1a UTSW 9 7475390 missense probably damaging 1.00
R2171:Mmp1a UTSW 9 7475356 missense probably damaging 0.99
R3415:Mmp1a UTSW 9 7464869 missense possibly damaging 0.92
R3901:Mmp1a UTSW 9 7475345 makesense probably null
R4175:Mmp1a UTSW 9 7467235 missense probably benign 0.03
R5406:Mmp1a UTSW 9 7467293 missense probably damaging 1.00
R6462:Mmp1a UTSW 9 7467038 missense probably benign 0.01
R7016:Mmp1a UTSW 9 7465083 makesense probably null
R7039:Mmp1a UTSW 9 7465083 makesense probably null
R7098:Mmp1a UTSW 9 7475937 missense probably benign 0.00
R7144:Mmp1a UTSW 9 7475318 missense probably damaging 1.00
R7196:Mmp1a UTSW 9 7476017 nonsense probably null
R7284:Mmp1a UTSW 9 7465083 makesense probably null
R7289:Mmp1a UTSW 9 7467293 missense probably damaging 1.00
R7313:Mmp1a UTSW 9 7465083 makesense probably null
R7510:Mmp1a UTSW 9 7465083 makesense probably null
R7537:Mmp1a UTSW 9 7465083 makesense probably null
R7574:Mmp1a UTSW 9 7465083 makesense probably null
R7626:Mmp1a UTSW 9 7465083 makesense probably null
R7755:Mmp1a UTSW 9 7467004 missense possibly damaging 0.92
R7789:Mmp1a UTSW 9 7475265 missense possibly damaging 0.70
R7791:Mmp1a UTSW 9 7465083 makesense probably null
R7900:Mmp1a UTSW 9 7465083 makesense probably null
R8000:Mmp1a UTSW 9 7476214 missense probably benign 0.11
R8009:Mmp1a UTSW 9 7467235 missense possibly damaging 0.76
R8039:Mmp1a UTSW 9 7465083 makesense probably null
R8072:Mmp1a UTSW 9 7465083 makesense probably null
R8497:Mmp1a UTSW 9 7465083 makesense probably null
R8884:Mmp1a UTSW 9 7465083 makesense probably null
R8890:Mmp1a UTSW 9 7465083 makesense probably null
RF004:Mmp1a UTSW 9 7465083 makesense probably null
X0020:Mmp1a UTSW 9 7465626 missense probably damaging 1.00
Z1177:Mmp1a UTSW 9 7464230 missense probably benign 0.21
Z1177:Mmp1a UTSW 9 7467033 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- AGAGTCTGGAGTGATGTGACACCAC -3'
(R):5'- TGTTTGCCAGGAGGAAGGCAATATG -3'

Sequencing Primer
(F):5'- TGGAAGAACATTGACTGCTCAAC -3'
(R):5'- GGCAATATGCAATCAGAAAATACTC -3'
Posted On2014-05-09