Incidental Mutation 'R1663:Olfr834'
ID186940
Institutional Source Beutler Lab
Gene Symbol Olfr834
Ensembl Gene ENSMUSG00000095525
Gene Nameolfactory receptor 834
SynonymsMOR153-2, GA_x6K02T2PVTD-12724921-12725859, MOR153-4_p
MMRRC Submission 039699-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.776) question?
Stock #R1663 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location18987990-18988928 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18988710 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 241 (C241S)
Ref Sequence ENSEMBL: ENSMUSP00000083680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086492]
Predicted Effect probably damaging
Transcript: ENSMUST00000086492
AA Change: C241S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000083680
Gene: ENSMUSG00000095525
AA Change: C241S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 7.2e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 305 7e-6 PFAM
Pfam:7tm_1 41 290 2.9e-20 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T A 8: 24,687,933 T11S probably benign Het
Adgb T C 10: 10,339,675 M1529V possibly damaging Het
Ankrd36 T A 11: 5,620,126 D531E possibly damaging Het
Ankzf1 C T 1: 75,196,270 P337S probably damaging Het
Apc A G 18: 34,268,325 I55V probably damaging Het
Aplnr A G 2: 85,136,694 D21G possibly damaging Het
Apol10b A T 15: 77,588,714 F47I probably damaging Het
Arhgef5 G A 6: 43,276,965 A1131T probably damaging Het
Arrb2 A T 11: 70,437,603 Q83L probably damaging Het
Atf7ip A G 6: 136,603,324 Q1082R possibly damaging Het
Atl2 A G 17: 79,864,711 S28P probably damaging Het
Brd7 T C 8: 88,358,023 K89E possibly damaging Het
Cc2d1b A G 4: 108,623,547 T55A probably damaging Het
Ccdc18 A G 5: 108,216,090 E1217G probably damaging Het
Cdc42ep4 A T 11: 113,729,451 M38K probably damaging Het
Cldn14 A G 16: 93,919,278 S227P probably damaging Het
Clspn T A 4: 126,565,975 C332S probably benign Het
Col5a1 T C 2: 27,951,476 S370P unknown Het
Comp T C 8: 70,373,600 L10P possibly damaging Het
Dcc A T 18: 71,826,052 N216K probably damaging Het
Dcstamp C T 15: 39,754,944 Q250* probably null Het
Drd5 T C 5: 38,320,855 F397S probably benign Het
Dst T C 1: 34,163,385 S265P probably damaging Het
Enam A T 5: 88,503,994 S1046C probably damaging Het
Eno3 T C 11: 70,662,274 probably null Het
Fam13a G A 6: 58,954,372 R408* probably null Het
Gipc2 T A 3: 152,094,164 M310L probably benign Het
Gm14496 T C 2: 181,997,437 V440A probably benign Het
Gzmg A T 14: 56,156,808 C210S probably damaging Het
Helb G T 10: 120,105,433 A450E probably damaging Het
Hepacam2 A T 6: 3,483,439 I190N possibly damaging Het
Hk3 A T 13: 55,006,575 S773T probably benign Het
Hnrnpc A G 14: 52,075,395 S221P probably damaging Het
Ifna9 T C 4: 88,591,983 T135A probably benign Het
Igfn1 C T 1: 135,968,308 G1507R probably benign Het
Kank3 A G 17: 33,818,375 T218A probably benign Het
Kcp G T 6: 29,498,965 R337S possibly damaging Het
Krt74 A T 15: 101,756,674 noncoding transcript Het
Lrp1 A T 10: 127,556,921 D2758E probably damaging Het
Ly75 T C 2: 60,314,234 E1295G probably damaging Het
Mccc1 C A 3: 35,978,933 W354L probably damaging Het
Mmp1a C T 9: 7,465,656 T198M probably benign Het
Mtmr2 C T 9: 13,803,501 T519I probably damaging Het
Nbea A G 3: 55,645,986 S2632P possibly damaging Het
Nbn T A 4: 15,970,903 D295E probably benign Het
Ndufb8 T C 19: 44,550,381 Y167C probably damaging Het
Nisch A G 14: 31,191,521 probably benign Het
Notch3 C T 17: 32,156,119 G407D probably damaging Het
Nucb1 A G 7: 45,498,864 F175S probably damaging Het
Olfr355 T G 2: 36,927,334 Y260S probably damaging Het
Olfr804 G A 10: 129,705,291 V138M probably benign Het
Olfr907 T G 9: 38,499,572 I301R unknown Het
Pip5k1c T C 10: 81,312,515 V425A probably damaging Het
Pnisr T A 4: 21,873,857 probably benign Het
Prkag1 A G 15: 98,815,895 V18A probably damaging Het
Rad50 T C 11: 53,668,223 N1063S probably benign Het
Rnf170 C T 8: 26,129,143 H132Y probably damaging Het
Rnf213 A G 11: 119,437,672 D1977G probably benign Het
Sema3a G A 5: 13,557,125 probably null Het
Setx T A 2: 29,126,905 C7S probably damaging Het
Slc23a2 A G 2: 132,065,464 I417T probably damaging Het
Spink6 T G 18: 44,071,521 F18C unknown Het
Sptbn1 T C 11: 30,120,783 Q1538R possibly damaging Het
Strn3 A G 12: 51,652,826 Y188H probably damaging Het
Tecpr1 C A 5: 144,197,944 K1040N probably benign Het
Tll1 T A 8: 64,017,686 Y901F probably benign Het
Tmem81 C T 1: 132,507,897 A147V probably benign Het
Tnpo3 T C 6: 29,565,759 D532G probably benign Het
Vmn2r19 T A 6: 123,336,452 I827N probably benign Het
Wdr35 A G 12: 9,020,000 K857R probably benign Het
Wdr60 T C 12: 116,229,610 Q574R probably benign Het
Zfp110 A G 7: 12,848,642 T406A probably benign Het
Zfp52 T C 17: 21,561,822 L644P possibly damaging Het
Zfp605 G A 5: 110,127,585 V190I probably benign Het
Zfp964 A G 8: 69,664,083 probably null Het
Zmynd8 A G 2: 165,807,885 S779P probably benign Het
Zswim5 T A 4: 116,986,895 N1043K probably damaging Het
Other mutations in Olfr834
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01804:Olfr834 APN 9 18988840 missense probably benign 0.16
IGL02073:Olfr834 APN 9 18988325 missense possibly damaging 0.89
IGL02119:Olfr834 APN 9 18988612 missense probably benign 0.00
IGL02705:Olfr834 APN 9 18988400 missense probably benign 0.03
R0462:Olfr834 UTSW 9 18988902 missense probably benign
R0466:Olfr834 UTSW 9 18988255 missense probably benign 0.00
R0709:Olfr834 UTSW 9 18988126 missense probably damaging 0.98
R0711:Olfr834 UTSW 9 18988151 missense probably benign 0.04
R1268:Olfr834 UTSW 9 18988356 missense probably damaging 0.98
R1680:Olfr834 UTSW 9 18988516 missense possibly damaging 0.81
R1686:Olfr834 UTSW 9 18988543 missense probably damaging 1.00
R1903:Olfr834 UTSW 9 18988896 nonsense probably null
R1907:Olfr834 UTSW 9 18988441 missense possibly damaging 0.82
R1911:Olfr834 UTSW 9 18988900 missense probably damaging 0.99
R2143:Olfr834 UTSW 9 18988803 missense probably benign 0.06
R2431:Olfr834 UTSW 9 18988003 missense probably damaging 1.00
R4014:Olfr834 UTSW 9 18988882 missense probably benign 0.08
R4515:Olfr834 UTSW 9 18987982 unclassified probably null
R4575:Olfr834 UTSW 9 18988705 nonsense probably null
R6974:Olfr834 UTSW 9 18988393 missense probably damaging 0.99
R7394:Olfr834 UTSW 9 18988710 missense probably damaging 0.99
R7455:Olfr834 UTSW 9 18988854 missense possibly damaging 0.92
R7828:Olfr834 UTSW 9 18988920 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTATCCTAGATGCACTGCTCCACA -3'
(R):5'- CCAGGTGACACATCAAAGGGAAGTT -3'

Sequencing Primer
(F):5'- GTGAACTGGCTCATATTCTCAAGC -3'
(R):5'- gagtttcttgaaagcactgacc -3'
Posted On2014-05-09