Incidental Mutation 'R1663:Pip5k1c'
ID186943
Institutional Source Beutler Lab
Gene Symbol Pip5k1c
Ensembl Gene ENSMUSG00000034902
Gene Namephosphatidylinositol-4-phosphate 5-kinase, type 1 gamma
SynonymsPIP5KIgamma
MMRRC Submission 039699-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1663 (G1)
Quality Score205
Status Not validated
Chromosome10
Chromosomal Location81292963-81319973 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81312515 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 425 (V425A)
Ref Sequence ENSEMBL: ENSMUSP00000038225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045469] [ENSMUST00000105327] [ENSMUST00000160291] [ENSMUST00000161719] [ENSMUST00000161854] [ENSMUST00000161869] [ENSMUST00000163075]
Predicted Effect probably damaging
Transcript: ENSMUST00000045469
AA Change: V425A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038225
Gene: ENSMUSG00000034902
AA Change: V425A

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 69 78 N/A INTRINSIC
PIPKc 103 444 2.72e-164 SMART
low complexity region 518 534 N/A INTRINSIC
low complexity region 575 591 N/A INTRINSIC
low complexity region 601 628 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105327
AA Change: V425A

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000100964
Gene: ENSMUSG00000034902
AA Change: V425A

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 69 78 N/A INTRINSIC
PIPKc 103 444 2.72e-164 SMART
low complexity region 518 534 N/A INTRINSIC
low complexity region 575 591 N/A INTRINSIC
low complexity region 601 628 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159636
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159895
Predicted Effect probably benign
Transcript: ENSMUST00000160291
SMART Domains Protein: ENSMUSP00000125645
Gene: ENSMUSG00000034902

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161586
SMART Domains Protein: ENSMUSP00000124612
Gene: ENSMUSG00000034902

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
low complexity region 54 81 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161719
AA Change: V115A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125461
Gene: ENSMUSG00000034902
AA Change: V115A

DomainStartEndE-ValueType
Pfam:PIP5K 1 133 1.4e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161854
SMART Domains Protein: ENSMUSP00000124004
Gene: ENSMUSG00000034902

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161869
SMART Domains Protein: ENSMUSP00000124235
Gene: ENSMUSG00000034902

DomainStartEndE-ValueType
low complexity region 7 36 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163075
AA Change: V425A

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124155
Gene: ENSMUSG00000034902
AA Change: V425A

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 69 78 N/A INTRINSIC
PIPKc 103 444 2.72e-164 SMART
low complexity region 518 534 N/A INTRINSIC
low complexity region 575 591 N/A INTRINSIC
low complexity region 601 628 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a type I phosphatidylinositol 4-phosphate 5-kinase. The encoded protein catalyzes phosphorylation of phosphatidylinositol 4-phosphate, producing phosphatidylinositol 4,5-bisphosphate. This enzyme is found at synapses and has been found to play roles in endocytosis and cell migration. Mutations at this locus have been associated with lethal congenital contractural syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Sep 2010]
PHENOTYPE: Mutations in this locus cause variable phenotypes. One allele shows embryonic lethality, abnormal cardiovascular and neuronal development and impaired integrity of the megakaryocyte membrane cytoskeleton. Another allele exhibits neonatal lethality, synaptic transmission and plasticity defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T A 8: 24,687,933 T11S probably benign Het
Adgb T C 10: 10,339,675 M1529V possibly damaging Het
Ankrd36 T A 11: 5,620,126 D531E possibly damaging Het
Ankzf1 C T 1: 75,196,270 P337S probably damaging Het
Apc A G 18: 34,268,325 I55V probably damaging Het
Aplnr A G 2: 85,136,694 D21G possibly damaging Het
Apol10b A T 15: 77,588,714 F47I probably damaging Het
Arhgef5 G A 6: 43,276,965 A1131T probably damaging Het
Arrb2 A T 11: 70,437,603 Q83L probably damaging Het
Atf7ip A G 6: 136,603,324 Q1082R possibly damaging Het
Atl2 A G 17: 79,864,711 S28P probably damaging Het
Brd7 T C 8: 88,358,023 K89E possibly damaging Het
Cc2d1b A G 4: 108,623,547 T55A probably damaging Het
Ccdc18 A G 5: 108,216,090 E1217G probably damaging Het
Cdc42ep4 A T 11: 113,729,451 M38K probably damaging Het
Cldn14 A G 16: 93,919,278 S227P probably damaging Het
Clspn T A 4: 126,565,975 C332S probably benign Het
Col5a1 T C 2: 27,951,476 S370P unknown Het
Comp T C 8: 70,373,600 L10P possibly damaging Het
Dcc A T 18: 71,826,052 N216K probably damaging Het
Dcstamp C T 15: 39,754,944 Q250* probably null Het
Drd5 T C 5: 38,320,855 F397S probably benign Het
Dst T C 1: 34,163,385 S265P probably damaging Het
Enam A T 5: 88,503,994 S1046C probably damaging Het
Eno3 T C 11: 70,662,274 probably null Het
Fam13a G A 6: 58,954,372 R408* probably null Het
Gipc2 T A 3: 152,094,164 M310L probably benign Het
Gm14496 T C 2: 181,997,437 V440A probably benign Het
Gzmg A T 14: 56,156,808 C210S probably damaging Het
Helb G T 10: 120,105,433 A450E probably damaging Het
Hepacam2 A T 6: 3,483,439 I190N possibly damaging Het
Hk3 A T 13: 55,006,575 S773T probably benign Het
Hnrnpc A G 14: 52,075,395 S221P probably damaging Het
Ifna9 T C 4: 88,591,983 T135A probably benign Het
Igfn1 C T 1: 135,968,308 G1507R probably benign Het
Kank3 A G 17: 33,818,375 T218A probably benign Het
Kcp G T 6: 29,498,965 R337S possibly damaging Het
Krt74 A T 15: 101,756,674 noncoding transcript Het
Lrp1 A T 10: 127,556,921 D2758E probably damaging Het
Ly75 T C 2: 60,314,234 E1295G probably damaging Het
Mccc1 C A 3: 35,978,933 W354L probably damaging Het
Mmp1a C T 9: 7,465,656 T198M probably benign Het
Mtmr2 C T 9: 13,803,501 T519I probably damaging Het
Nbea A G 3: 55,645,986 S2632P possibly damaging Het
Nbn T A 4: 15,970,903 D295E probably benign Het
Ndufb8 T C 19: 44,550,381 Y167C probably damaging Het
Nisch A G 14: 31,191,521 probably benign Het
Notch3 C T 17: 32,156,119 G407D probably damaging Het
Nucb1 A G 7: 45,498,864 F175S probably damaging Het
Olfr355 T G 2: 36,927,334 Y260S probably damaging Het
Olfr804 G A 10: 129,705,291 V138M probably benign Het
Olfr834 T A 9: 18,988,710 C241S probably damaging Het
Olfr907 T G 9: 38,499,572 I301R unknown Het
Pnisr T A 4: 21,873,857 probably benign Het
Prkag1 A G 15: 98,815,895 V18A probably damaging Het
Rad50 T C 11: 53,668,223 N1063S probably benign Het
Rnf170 C T 8: 26,129,143 H132Y probably damaging Het
Rnf213 A G 11: 119,437,672 D1977G probably benign Het
Sema3a G A 5: 13,557,125 probably null Het
Setx T A 2: 29,126,905 C7S probably damaging Het
Slc23a2 A G 2: 132,065,464 I417T probably damaging Het
Spink6 T G 18: 44,071,521 F18C unknown Het
Sptbn1 T C 11: 30,120,783 Q1538R possibly damaging Het
Strn3 A G 12: 51,652,826 Y188H probably damaging Het
Tecpr1 C A 5: 144,197,944 K1040N probably benign Het
Tll1 T A 8: 64,017,686 Y901F probably benign Het
Tmem81 C T 1: 132,507,897 A147V probably benign Het
Tnpo3 T C 6: 29,565,759 D532G probably benign Het
Vmn2r19 T A 6: 123,336,452 I827N probably benign Het
Wdr35 A G 12: 9,020,000 K857R probably benign Het
Wdr60 T C 12: 116,229,610 Q574R probably benign Het
Zfp110 A G 7: 12,848,642 T406A probably benign Het
Zfp52 T C 17: 21,561,822 L644P possibly damaging Het
Zfp605 G A 5: 110,127,585 V190I probably benign Het
Zfp964 A G 8: 69,664,083 probably null Het
Zmynd8 A G 2: 165,807,885 S779P probably benign Het
Zswim5 T A 4: 116,986,895 N1043K probably damaging Het
Other mutations in Pip5k1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Pip5k1c APN 10 81305711 missense probably benign 0.45
IGL02274:Pip5k1c APN 10 81306384 missense probably damaging 1.00
IGL02500:Pip5k1c APN 10 81317321 splice site probably null
IGL02565:Pip5k1c APN 10 81317321 splice site probably null
IGL02577:Pip5k1c APN 10 81317321 splice site probably null
IGL02579:Pip5k1c APN 10 81317321 splice site probably null
IGL02581:Pip5k1c APN 10 81317321 splice site probably null
IGL02604:Pip5k1c APN 10 81317321 splice site probably null
IGL02610:Pip5k1c APN 10 81317321 splice site probably null
IGL02613:Pip5k1c APN 10 81317321 splice site probably null
IGL02616:Pip5k1c APN 10 81317321 splice site probably null
IGL02617:Pip5k1c APN 10 81317321 splice site probably null
IGL02639:Pip5k1c APN 10 81317321 splice site probably null
IGL02641:Pip5k1c APN 10 81317321 splice site probably null
IGL02642:Pip5k1c APN 10 81317321 splice site probably null
IGL02724:Pip5k1c APN 10 81313462 missense probably benign 0.01
IGL02751:Pip5k1c APN 10 81317321 splice site probably null
PIT4366001:Pip5k1c UTSW 10 81309008 missense probably damaging 0.98
R0257:Pip5k1c UTSW 10 81315096 missense possibly damaging 0.86
R1643:Pip5k1c UTSW 10 81314994 missense probably damaging 1.00
R1872:Pip5k1c UTSW 10 81306319 missense probably damaging 0.99
R2293:Pip5k1c UTSW 10 81314084 missense possibly damaging 0.82
R2295:Pip5k1c UTSW 10 81305186 missense probably benign 0.40
R2310:Pip5k1c UTSW 10 81306308 missense probably damaging 0.96
R2406:Pip5k1c UTSW 10 81309024 missense probably damaging 1.00
R4504:Pip5k1c UTSW 10 81315111 missense probably damaging 0.98
R4772:Pip5k1c UTSW 10 81315940 missense probably benign
R5022:Pip5k1c UTSW 10 81310889 splice site probably null
R5023:Pip5k1c UTSW 10 81310889 splice site probably null
R5033:Pip5k1c UTSW 10 81305250 missense probably damaging 0.99
R5057:Pip5k1c UTSW 10 81310889 splice site probably null
R5482:Pip5k1c UTSW 10 81293063 missense probably damaging 0.98
R6305:Pip5k1c UTSW 10 81315934 missense probably benign 0.02
R6511:Pip5k1c UTSW 10 81310817 missense probably damaging 1.00
R6544:Pip5k1c UTSW 10 81308996 missense probably damaging 1.00
R7512:Pip5k1c UTSW 10 81315119 critical splice donor site probably null
R7581:Pip5k1c UTSW 10 81308960 missense probably damaging 1.00
Z1177:Pip5k1c UTSW 10 81315032 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- ACTCCAGTGTTCAAGACTCCCACTC -3'
(R):5'- TGTGAACTGGTGACATGCAGGC -3'

Sequencing Primer
(F):5'- cctgtcattcggccactc -3'
(R):5'- ACATGCAGGCCCTCTGG -3'
Posted On2014-05-09