Incidental Mutation 'R1663:Sptbn1'
ID186948
Institutional Source Beutler Lab
Gene Symbol Sptbn1
Ensembl Gene ENSMUSG00000020315
Gene Namespectrin beta, non-erythrocytic 1
Synonymsnon-erythrocytic, Spnb-2, elf3, 9930031C03Rik, elf1, beta fodrin, brain spectrin, spectrin G, Spnb2
MMRRC Submission 039699-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1663 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location30099395-30268175 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30120783 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 1538 (Q1538R)
Ref Sequence ENSEMBL: ENSMUSP00000114841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006629] [ENSMUST00000011877] [ENSMUST00000102838] [ENSMUST00000124231]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006629
AA Change: Q1538R

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000006629
Gene: ENSMUSG00000020315
AA Change: Q1538R

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
CH 56 156 3.02e-28 SMART
CH 175 273 8.73e-25 SMART
SPEC 305 411 2.03e0 SMART
SPEC 425 525 6.42e-26 SMART
SPEC 531 635 4.61e-27 SMART
SPEC 641 741 2.36e-33 SMART
SPEC 747 846 1.2e-25 SMART
SPEC 852 952 7.16e-24 SMART
SPEC 958 1059 6.58e-23 SMART
SPEC 1065 1166 1.79e-24 SMART
SPEC 1172 1272 2.2e-24 SMART
SPEC 1278 1377 5.18e-21 SMART
SPEC 1383 1482 1.02e-19 SMART
SPEC 1488 1589 7.2e-29 SMART
SPEC 1595 1695 8.03e-27 SMART
SPEC 1701 1802 9.73e-26 SMART
SPEC 1808 1908 9.82e-22 SMART
SPEC 1914 2014 8.68e-23 SMART
SPEC 2020 2162 3.1e-10 SMART
PH 2197 2308 1.64e-18 SMART
low complexity region 2312 2327 N/A INTRINSIC
low complexity region 2343 2355 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000011877
AA Change: Q1538R

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000011877
Gene: ENSMUSG00000020315
AA Change: Q1538R

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
CH 56 156 3.02e-28 SMART
CH 175 273 8.73e-25 SMART
SPEC 305 411 2.03e0 SMART
SPEC 425 525 6.42e-26 SMART
SPEC 531 635 4.61e-27 SMART
SPEC 641 741 2.36e-33 SMART
SPEC 747 846 1.2e-25 SMART
SPEC 852 952 7.16e-24 SMART
SPEC 958 1059 6.58e-23 SMART
SPEC 1065 1166 1.79e-24 SMART
SPEC 1172 1272 2.2e-24 SMART
SPEC 1278 1377 5.18e-21 SMART
SPEC 1383 1482 1.02e-19 SMART
SPEC 1488 1589 7.2e-29 SMART
SPEC 1595 1695 8.03e-27 SMART
SPEC 1701 1802 9.73e-26 SMART
SPEC 1808 1908 9.82e-22 SMART
SPEC 1914 2014 8.68e-23 SMART
SPEC 2020 2162 3.1e-10 SMART
PH 2197 2308 1.64e-18 SMART
low complexity region 2312 2327 N/A INTRINSIC
low complexity region 2343 2355 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102838
AA Change: Q1525R

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099902
Gene: ENSMUSG00000020315
AA Change: Q1525R

DomainStartEndE-ValueType
CH 43 143 3.02e-28 SMART
CH 162 260 8.73e-25 SMART
SPEC 292 398 2.03e0 SMART
SPEC 412 512 6.42e-26 SMART
SPEC 518 622 4.61e-27 SMART
SPEC 628 728 2.36e-33 SMART
SPEC 734 833 1.2e-25 SMART
SPEC 839 939 7.16e-24 SMART
SPEC 945 1046 6.58e-23 SMART
SPEC 1052 1153 1.79e-24 SMART
SPEC 1159 1259 2.2e-24 SMART
SPEC 1265 1364 5.18e-21 SMART
SPEC 1370 1469 1.02e-19 SMART
SPEC 1475 1576 7.2e-29 SMART
SPEC 1582 1682 8.03e-27 SMART
SPEC 1688 1789 9.73e-26 SMART
SPEC 1795 1895 9.82e-22 SMART
SPEC 1901 2001 8.68e-23 SMART
SPEC 2007 2114 2.66e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000124231
AA Change: Q1538R

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000114841
Gene: ENSMUSG00000020315
AA Change: Q1538R

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
CH 56 156 3.02e-28 SMART
CH 175 273 8.73e-25 SMART
SPEC 305 411 2.03e0 SMART
SPEC 425 525 6.42e-26 SMART
SPEC 531 635 4.61e-27 SMART
SPEC 641 741 2.36e-33 SMART
SPEC 747 846 1.2e-25 SMART
SPEC 852 952 7.16e-24 SMART
SPEC 958 1059 6.58e-23 SMART
SPEC 1065 1166 1.79e-24 SMART
SPEC 1172 1272 2.2e-24 SMART
SPEC 1278 1377 5.18e-21 SMART
SPEC 1383 1482 1.02e-19 SMART
SPEC 1488 1589 7.2e-29 SMART
SPEC 1595 1695 8.03e-27 SMART
SPEC 1701 1802 9.73e-26 SMART
SPEC 1808 1908 9.82e-22 SMART
SPEC 1914 2014 8.68e-23 SMART
SPEC 2020 2092 6.42e-2 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is composed of two antiparallel dimers of alpha- and beta- subunits. This gene is one member of a family of beta-spectrin genes. The encoded protein contains an N-terminal actin-binding domain, and 17 spectrin repeats which are involved in dimer formation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to mid-gestational lethality due to gastrointestinal, liver, neural, and cardiac defects, whereas heterozygotes survive until adulthood and spontaneously develop cancers in several organs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T A 8: 24,687,933 T11S probably benign Het
Adgb T C 10: 10,339,675 M1529V possibly damaging Het
Ankrd36 T A 11: 5,620,126 D531E possibly damaging Het
Ankzf1 C T 1: 75,196,270 P337S probably damaging Het
Apc A G 18: 34,268,325 I55V probably damaging Het
Aplnr A G 2: 85,136,694 D21G possibly damaging Het
Apol10b A T 15: 77,588,714 F47I probably damaging Het
Arhgef5 G A 6: 43,276,965 A1131T probably damaging Het
Arrb2 A T 11: 70,437,603 Q83L probably damaging Het
Atf7ip A G 6: 136,603,324 Q1082R possibly damaging Het
Atl2 A G 17: 79,864,711 S28P probably damaging Het
Brd7 T C 8: 88,358,023 K89E possibly damaging Het
Cc2d1b A G 4: 108,623,547 T55A probably damaging Het
Ccdc18 A G 5: 108,216,090 E1217G probably damaging Het
Cdc42ep4 A T 11: 113,729,451 M38K probably damaging Het
Cldn14 A G 16: 93,919,278 S227P probably damaging Het
Clspn T A 4: 126,565,975 C332S probably benign Het
Col5a1 T C 2: 27,951,476 S370P unknown Het
Comp T C 8: 70,373,600 L10P possibly damaging Het
Dcc A T 18: 71,826,052 N216K probably damaging Het
Dcstamp C T 15: 39,754,944 Q250* probably null Het
Drd5 T C 5: 38,320,855 F397S probably benign Het
Dst T C 1: 34,163,385 S265P probably damaging Het
Enam A T 5: 88,503,994 S1046C probably damaging Het
Eno3 T C 11: 70,662,274 probably null Het
Fam13a G A 6: 58,954,372 R408* probably null Het
Gipc2 T A 3: 152,094,164 M310L probably benign Het
Gm14496 T C 2: 181,997,437 V440A probably benign Het
Gzmg A T 14: 56,156,808 C210S probably damaging Het
Helb G T 10: 120,105,433 A450E probably damaging Het
Hepacam2 A T 6: 3,483,439 I190N possibly damaging Het
Hk3 A T 13: 55,006,575 S773T probably benign Het
Hnrnpc A G 14: 52,075,395 S221P probably damaging Het
Ifna9 T C 4: 88,591,983 T135A probably benign Het
Igfn1 C T 1: 135,968,308 G1507R probably benign Het
Kank3 A G 17: 33,818,375 T218A probably benign Het
Kcp G T 6: 29,498,965 R337S possibly damaging Het
Krt74 A T 15: 101,756,674 noncoding transcript Het
Lrp1 A T 10: 127,556,921 D2758E probably damaging Het
Ly75 T C 2: 60,314,234 E1295G probably damaging Het
Mccc1 C A 3: 35,978,933 W354L probably damaging Het
Mmp1a C T 9: 7,465,656 T198M probably benign Het
Mtmr2 C T 9: 13,803,501 T519I probably damaging Het
Nbea A G 3: 55,645,986 S2632P possibly damaging Het
Nbn T A 4: 15,970,903 D295E probably benign Het
Ndufb8 T C 19: 44,550,381 Y167C probably damaging Het
Nisch A G 14: 31,191,521 probably benign Het
Notch3 C T 17: 32,156,119 G407D probably damaging Het
Nucb1 A G 7: 45,498,864 F175S probably damaging Het
Olfr355 T G 2: 36,927,334 Y260S probably damaging Het
Olfr804 G A 10: 129,705,291 V138M probably benign Het
Olfr834 T A 9: 18,988,710 C241S probably damaging Het
Olfr907 T G 9: 38,499,572 I301R unknown Het
Pip5k1c T C 10: 81,312,515 V425A probably damaging Het
Pnisr T A 4: 21,873,857 probably benign Het
Prkag1 A G 15: 98,815,895 V18A probably damaging Het
Rad50 T C 11: 53,668,223 N1063S probably benign Het
Rnf170 C T 8: 26,129,143 H132Y probably damaging Het
Rnf213 A G 11: 119,437,672 D1977G probably benign Het
Sema3a G A 5: 13,557,125 probably null Het
Setx T A 2: 29,126,905 C7S probably damaging Het
Slc23a2 A G 2: 132,065,464 I417T probably damaging Het
Spink6 T G 18: 44,071,521 F18C unknown Het
Strn3 A G 12: 51,652,826 Y188H probably damaging Het
Tecpr1 C A 5: 144,197,944 K1040N probably benign Het
Tll1 T A 8: 64,017,686 Y901F probably benign Het
Tmem81 C T 1: 132,507,897 A147V probably benign Het
Tnpo3 T C 6: 29,565,759 D532G probably benign Het
Vmn2r19 T A 6: 123,336,452 I827N probably benign Het
Wdr35 A G 12: 9,020,000 K857R probably benign Het
Wdr60 T C 12: 116,229,610 Q574R probably benign Het
Zfp110 A G 7: 12,848,642 T406A probably benign Het
Zfp52 T C 17: 21,561,822 L644P possibly damaging Het
Zfp605 G A 5: 110,127,585 V190I probably benign Het
Zfp964 A G 8: 69,664,083 probably null Het
Zmynd8 A G 2: 165,807,885 S779P probably benign Het
Zswim5 T A 4: 116,986,895 N1043K probably damaging Het
Other mutations in Sptbn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Sptbn1 APN 11 30110818 nonsense probably null
IGL01098:Sptbn1 APN 11 30159385 missense probably damaging 1.00
IGL01843:Sptbn1 APN 11 30104623 missense probably benign 0.02
IGL02070:Sptbn1 APN 11 30145979 missense probably damaging 0.99
IGL02075:Sptbn1 APN 11 30138496 missense probably damaging 1.00
IGL02094:Sptbn1 APN 11 30100659 missense probably benign 0.01
IGL02102:Sptbn1 APN 11 30137427 missense probably damaging 1.00
IGL02189:Sptbn1 APN 11 30117871 missense probably damaging 1.00
IGL02256:Sptbn1 APN 11 30120990 missense probably benign 0.24
IGL02301:Sptbn1 APN 11 30142129 missense probably damaging 1.00
IGL02354:Sptbn1 APN 11 30110783 missense probably damaging 1.00
IGL02361:Sptbn1 APN 11 30110783 missense probably damaging 1.00
IGL02377:Sptbn1 APN 11 30119491 missense possibly damaging 0.92
IGL02504:Sptbn1 APN 11 30142293 missense probably damaging 1.00
IGL02672:Sptbn1 APN 11 30137239 missense probably damaging 1.00
IGL02733:Sptbn1 APN 11 30197747 missense probably benign 0.12
IGL02755:Sptbn1 APN 11 30142247 missense probably damaging 1.00
R0006:Sptbn1 UTSW 11 30123855 missense probably damaging 1.00
R0006:Sptbn1 UTSW 11 30123855 missense probably damaging 1.00
R0096:Sptbn1 UTSW 11 30114739 missense probably damaging 1.00
R0139:Sptbn1 UTSW 11 30142289 missense probably benign 0.00
R0370:Sptbn1 UTSW 11 30121545 missense probably benign
R0389:Sptbn1 UTSW 11 30139250 missense possibly damaging 0.95
R0415:Sptbn1 UTSW 11 30149576 missense probably damaging 1.00
R0552:Sptbn1 UTSW 11 30145985 missense possibly damaging 0.92
R0601:Sptbn1 UTSW 11 30150008 missense probably damaging 1.00
R0609:Sptbn1 UTSW 11 30138979 missense probably damaging 1.00
R0675:Sptbn1 UTSW 11 30117903 missense probably damaging 1.00
R0708:Sptbn1 UTSW 11 30114739 missense probably damaging 1.00
R0711:Sptbn1 UTSW 11 30114739 missense probably damaging 1.00
R0729:Sptbn1 UTSW 11 30110902 missense probably damaging 0.96
R0755:Sptbn1 UTSW 11 30139016 missense probably damaging 1.00
R0892:Sptbn1 UTSW 11 30142201 missense probably damaging 1.00
R0927:Sptbn1 UTSW 11 30121591 missense probably damaging 1.00
R1102:Sptbn1 UTSW 11 30120785 missense possibly damaging 0.93
R1460:Sptbn1 UTSW 11 30138637 missense possibly damaging 0.50
R1479:Sptbn1 UTSW 11 30113909 missense probably damaging 1.00
R1496:Sptbn1 UTSW 11 30121498 missense probably damaging 1.00
R1649:Sptbn1 UTSW 11 30137301 missense probably damaging 0.97
R1671:Sptbn1 UTSW 11 30142245 missense possibly damaging 0.57
R1680:Sptbn1 UTSW 11 30159371 missense possibly damaging 0.92
R1695:Sptbn1 UTSW 11 30136124 missense probably benign 0.13
R1868:Sptbn1 UTSW 11 30114781 missense possibly damaging 0.70
R1918:Sptbn1 UTSW 11 30142414 missense probably damaging 1.00
R1921:Sptbn1 UTSW 11 30104469 missense probably damaging 0.98
R2026:Sptbn1 UTSW 11 30104559 missense probably benign 0.02
R2038:Sptbn1 UTSW 11 30159293 critical splice donor site probably null
R2047:Sptbn1 UTSW 11 30138360 splice site probably benign
R2312:Sptbn1 UTSW 11 30154249 missense probably damaging 1.00
R3430:Sptbn1 UTSW 11 30219686 missense possibly damaging 0.67
R3624:Sptbn1 UTSW 11 30140593 missense probably damaging 1.00
R3723:Sptbn1 UTSW 11 30137335 missense possibly damaging 0.59
R3862:Sptbn1 UTSW 11 30142329 missense possibly damaging 0.63
R4446:Sptbn1 UTSW 11 30139114 missense possibly damaging 0.70
R4582:Sptbn1 UTSW 11 30219597 missense probably damaging 1.00
R4705:Sptbn1 UTSW 11 30100660 missense probably benign
R4707:Sptbn1 UTSW 11 30137197 missense possibly damaging 0.61
R4718:Sptbn1 UTSW 11 30154297 missense probably damaging 1.00
R4789:Sptbn1 UTSW 11 30117759 missense probably benign
R4824:Sptbn1 UTSW 11 30118295 missense possibly damaging 0.72
R4855:Sptbn1 UTSW 11 30142353 missense probably damaging 1.00
R5009:Sptbn1 UTSW 11 30124016 missense probably benign 0.05
R5071:Sptbn1 UTSW 11 30113854 critical splice donor site probably null
R5153:Sptbn1 UTSW 11 30121510 missense possibly damaging 0.82
R5334:Sptbn1 UTSW 11 30137364 missense possibly damaging 0.92
R5462:Sptbn1 UTSW 11 30100520 missense possibly damaging 0.94
R5523:Sptbn1 UTSW 11 30137560 missense probably damaging 1.00
R5707:Sptbn1 UTSW 11 30143174 missense possibly damaging 0.65
R5724:Sptbn1 UTSW 11 30144113 missense possibly damaging 0.91
R5738:Sptbn1 UTSW 11 30145941 missense probably damaging 1.00
R5864:Sptbn1 UTSW 11 30145925 missense probably damaging 1.00
R5895:Sptbn1 UTSW 11 30123978 missense probably damaging 0.99
R5932:Sptbn1 UTSW 11 30136136 missense probably damaging 1.00
R5966:Sptbn1 UTSW 11 30124873 missense probably damaging 1.00
R5984:Sptbn1 UTSW 11 30118464 missense probably damaging 1.00
R6155:Sptbn1 UTSW 11 30137403 missense probably damaging 0.99
R6163:Sptbn1 UTSW 11 30159443 nonsense probably null
R6226:Sptbn1 UTSW 11 30136054 missense probably damaging 1.00
R6271:Sptbn1 UTSW 11 30100660 missense probably benign 0.00
R6443:Sptbn1 UTSW 11 30139429 missense possibly damaging 0.56
R6591:Sptbn1 UTSW 11 30113984 missense probably damaging 0.99
R6616:Sptbn1 UTSW 11 30124030 missense probably benign 0.08
R6691:Sptbn1 UTSW 11 30113984 missense probably damaging 0.99
R6751:Sptbn1 UTSW 11 30117859 missense probably damaging 1.00
R6823:Sptbn1 UTSW 11 30114787 missense probably damaging 1.00
R6863:Sptbn1 UTSW 11 30146777 missense possibly damaging 0.94
R6885:Sptbn1 UTSW 11 30138634 missense probably benign 0.26
R6892:Sptbn1 UTSW 11 30142187 missense probably benign 0.27
R6998:Sptbn1 UTSW 11 30100633 missense probably damaging 0.97
R7043:Sptbn1 UTSW 11 30103323 missense probably benign 0.02
R7092:Sptbn1 UTSW 11 30137119 missense possibly damaging 0.75
R7272:Sptbn1 UTSW 11 30114859 missense possibly damaging 0.93
R7301:Sptbn1 UTSW 11 30117798 nonsense probably null
R7379:Sptbn1 UTSW 11 30139292 missense possibly damaging 0.72
R7774:Sptbn1 UTSW 11 30142142 missense probably damaging 0.99
R7813:Sptbn1 UTSW 11 30138455 missense probably damaging 1.00
R7837:Sptbn1 UTSW 11 30138832 missense probably damaging 1.00
R7843:Sptbn1 UTSW 11 30154320 missense probably damaging 1.00
R7846:Sptbn1 UTSW 11 30142153 missense probably damaging 0.98
R7877:Sptbn1 UTSW 11 30129601 missense possibly damaging 0.94
R7902:Sptbn1 UTSW 11 30136048 missense probably damaging 1.00
R7920:Sptbn1 UTSW 11 30138832 missense probably damaging 1.00
R7926:Sptbn1 UTSW 11 30154320 missense probably damaging 1.00
R7929:Sptbn1 UTSW 11 30142153 missense probably damaging 0.98
R7960:Sptbn1 UTSW 11 30129601 missense possibly damaging 0.94
R7985:Sptbn1 UTSW 11 30136048 missense probably damaging 1.00
R8060:Sptbn1 UTSW 11 30101616 missense probably damaging 0.99
Z1176:Sptbn1 UTSW 11 30137439 missense probably damaging 1.00
Z1176:Sptbn1 UTSW 11 30197787 missense probably benign 0.13
Z1177:Sptbn1 UTSW 11 30120659 missense probably benign 0.27
Z1177:Sptbn1 UTSW 11 30114734 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGGCACTCTTCTGAGGCATACC -3'
(R):5'- TGGCAACTTCCACAGATCATGGC -3'

Sequencing Primer
(F):5'- AGTTGGGAAGCATCTCTCAC -3'
(R):5'- CCAGGTAAGCTTTTCTACCAAGG -3'
Posted On2014-05-09