Incidental Mutation 'R1663:Eno3'
ID186951
Institutional Source Beutler Lab
Gene Symbol Eno3
Ensembl Gene ENSMUSG00000060600
Gene Nameenolase 3, beta muscle
SynonymsEno-3
MMRRC Submission 039699-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.290) question?
Stock #R1663 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location70657202-70662513 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 70662274 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018431] [ENSMUST00000072841] [ENSMUST00000108548] [ENSMUST00000126241] [ENSMUST00000129434] [ENSMUST00000134087] [ENSMUST00000157027] [ENSMUST00000170716]
Predicted Effect probably benign
Transcript: ENSMUST00000018431
SMART Domains Protein: ENSMUSP00000018431
Gene: ENSMUSG00000018287

DomainStartEndE-ValueType
R3H 31 109 3.85e-21 SMART
low complexity region 130 152 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000072841
SMART Domains Protein: ENSMUSP00000072620
Gene: ENSMUSG00000060600

DomainStartEndE-ValueType
Enolase_N 3 134 6.26e-91 SMART
Enolase_C 142 431 8.8e-200 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108548
SMART Domains Protein: ENSMUSP00000104188
Gene: ENSMUSG00000060600

DomainStartEndE-ValueType
Enolase_N 3 134 6.26e-91 SMART
Enolase_C 142 431 8.8e-200 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124691
Predicted Effect probably benign
Transcript: ENSMUST00000126241
SMART Domains Protein: ENSMUSP00000123688
Gene: ENSMUSG00000060600

DomainStartEndE-ValueType
Enolase_N 3 70 7.82e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129434
SMART Domains Protein: ENSMUSP00000115098
Gene: ENSMUSG00000018287

DomainStartEndE-ValueType
R3H 22 99 3.06e-15 SMART
low complexity region 120 142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134087
SMART Domains Protein: ENSMUSP00000121640
Gene: ENSMUSG00000060600

DomainStartEndE-ValueType
Enolase_N 3 78 3.53e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137691
Predicted Effect probably benign
Transcript: ENSMUST00000157027
SMART Domains Protein: ENSMUSP00000115726
Gene: ENSMUSG00000060600

DomainStartEndE-ValueType
Enolase_N 3 134 6.26e-91 SMART
Pfam:Enolase_C 142 196 1e-29 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170716
SMART Domains Protein: ENSMUSP00000128714
Gene: ENSMUSG00000060600

DomainStartEndE-ValueType
Enolase_N 3 134 6.26e-91 SMART
Enolase_C 142 431 8.8e-200 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179055
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179738
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes one of the three enolase isoenzymes found in vertebrates. Enolase is a dimeric enzyme that converts 2-phosphoglycerate to phosphoenolpyruvate as part of the glycolytic pathway. This isozyme is found in skeletal muscle where it is involved in muscle development and regeneration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T A 8: 24,687,933 T11S probably benign Het
Adgb T C 10: 10,339,675 M1529V possibly damaging Het
Ankrd36 T A 11: 5,620,126 D531E possibly damaging Het
Ankzf1 C T 1: 75,196,270 P337S probably damaging Het
Apc A G 18: 34,268,325 I55V probably damaging Het
Aplnr A G 2: 85,136,694 D21G possibly damaging Het
Apol10b A T 15: 77,588,714 F47I probably damaging Het
Arhgef5 G A 6: 43,276,965 A1131T probably damaging Het
Arrb2 A T 11: 70,437,603 Q83L probably damaging Het
Atf7ip A G 6: 136,603,324 Q1082R possibly damaging Het
Atl2 A G 17: 79,864,711 S28P probably damaging Het
Brd7 T C 8: 88,358,023 K89E possibly damaging Het
Cc2d1b A G 4: 108,623,547 T55A probably damaging Het
Ccdc18 A G 5: 108,216,090 E1217G probably damaging Het
Cdc42ep4 A T 11: 113,729,451 M38K probably damaging Het
Cldn14 A G 16: 93,919,278 S227P probably damaging Het
Clspn T A 4: 126,565,975 C332S probably benign Het
Col5a1 T C 2: 27,951,476 S370P unknown Het
Comp T C 8: 70,373,600 L10P possibly damaging Het
Dcc A T 18: 71,826,052 N216K probably damaging Het
Dcstamp C T 15: 39,754,944 Q250* probably null Het
Drd5 T C 5: 38,320,855 F397S probably benign Het
Dst T C 1: 34,163,385 S265P probably damaging Het
Enam A T 5: 88,503,994 S1046C probably damaging Het
Fam13a G A 6: 58,954,372 R408* probably null Het
Gipc2 T A 3: 152,094,164 M310L probably benign Het
Gm14496 T C 2: 181,997,437 V440A probably benign Het
Gzmg A T 14: 56,156,808 C210S probably damaging Het
Helb G T 10: 120,105,433 A450E probably damaging Het
Hepacam2 A T 6: 3,483,439 I190N possibly damaging Het
Hk3 A T 13: 55,006,575 S773T probably benign Het
Hnrnpc A G 14: 52,075,395 S221P probably damaging Het
Ifna9 T C 4: 88,591,983 T135A probably benign Het
Igfn1 C T 1: 135,968,308 G1507R probably benign Het
Kank3 A G 17: 33,818,375 T218A probably benign Het
Kcp G T 6: 29,498,965 R337S possibly damaging Het
Krt74 A T 15: 101,756,674 noncoding transcript Het
Lrp1 A T 10: 127,556,921 D2758E probably damaging Het
Ly75 T C 2: 60,314,234 E1295G probably damaging Het
Mccc1 C A 3: 35,978,933 W354L probably damaging Het
Mmp1a C T 9: 7,465,656 T198M probably benign Het
Mtmr2 C T 9: 13,803,501 T519I probably damaging Het
Nbea A G 3: 55,645,986 S2632P possibly damaging Het
Nbn T A 4: 15,970,903 D295E probably benign Het
Ndufb8 T C 19: 44,550,381 Y167C probably damaging Het
Nisch A G 14: 31,191,521 probably benign Het
Notch3 C T 17: 32,156,119 G407D probably damaging Het
Nucb1 A G 7: 45,498,864 F175S probably damaging Het
Olfr355 T G 2: 36,927,334 Y260S probably damaging Het
Olfr804 G A 10: 129,705,291 V138M probably benign Het
Olfr834 T A 9: 18,988,710 C241S probably damaging Het
Olfr907 T G 9: 38,499,572 I301R unknown Het
Pip5k1c T C 10: 81,312,515 V425A probably damaging Het
Pnisr T A 4: 21,873,857 probably benign Het
Prkag1 A G 15: 98,815,895 V18A probably damaging Het
Rad50 T C 11: 53,668,223 N1063S probably benign Het
Rnf170 C T 8: 26,129,143 H132Y probably damaging Het
Rnf213 A G 11: 119,437,672 D1977G probably benign Het
Sema3a G A 5: 13,557,125 probably null Het
Setx T A 2: 29,126,905 C7S probably damaging Het
Slc23a2 A G 2: 132,065,464 I417T probably damaging Het
Spink6 T G 18: 44,071,521 F18C unknown Het
Sptbn1 T C 11: 30,120,783 Q1538R possibly damaging Het
Strn3 A G 12: 51,652,826 Y188H probably damaging Het
Tecpr1 C A 5: 144,197,944 K1040N probably benign Het
Tll1 T A 8: 64,017,686 Y901F probably benign Het
Tmem81 C T 1: 132,507,897 A147V probably benign Het
Tnpo3 T C 6: 29,565,759 D532G probably benign Het
Vmn2r19 T A 6: 123,336,452 I827N probably benign Het
Wdr35 A G 12: 9,020,000 K857R probably benign Het
Wdr60 T C 12: 116,229,610 Q574R probably benign Het
Zfp110 A G 7: 12,848,642 T406A probably benign Het
Zfp52 T C 17: 21,561,822 L644P possibly damaging Het
Zfp605 G A 5: 110,127,585 V190I probably benign Het
Zfp964 A G 8: 69,664,083 probably null Het
Zmynd8 A G 2: 165,807,885 S779P probably benign Het
Zswim5 T A 4: 116,986,895 N1043K probably damaging Het
Other mutations in Eno3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02479:Eno3 APN 11 70660888 splice site probably benign
IGL02591:Eno3 APN 11 70662027 missense probably damaging 1.00
IGL02868:Eno3 APN 11 70662000 missense probably damaging 1.00
R0242:Eno3 UTSW 11 70657935 missense probably null 1.00
R0242:Eno3 UTSW 11 70657935 missense probably null 1.00
R0970:Eno3 UTSW 11 70660802 missense probably damaging 1.00
R1518:Eno3 UTSW 11 70661077 nonsense probably null
R1587:Eno3 UTSW 11 70661470 missense probably damaging 0.99
R1675:Eno3 UTSW 11 70658666 critical splice donor site probably null
R1758:Eno3 UTSW 11 70661425 missense possibly damaging 0.77
R3983:Eno3 UTSW 11 70661411 missense probably damaging 0.98
R4990:Eno3 UTSW 11 70658647 missense probably damaging 0.99
R4992:Eno3 UTSW 11 70658647 missense probably damaging 0.99
R5170:Eno3 UTSW 11 70662214 missense probably benign 0.00
R6116:Eno3 UTSW 11 70661575 missense possibly damaging 0.70
R6917:Eno3 UTSW 11 70661436 missense probably benign
R7060:Eno3 UTSW 11 70661419 missense possibly damaging 0.95
R7128:Eno3 UTSW 11 70658604 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- ACCGAAGACACTTTCATCGCTGAC -3'
(R):5'- AGGAACACAGCATGGTCTGGTTTG -3'

Sequencing Primer
(F):5'- TCTGCACAGGACAGGTACTC -3'
(R):5'- TCCTGTGAAAGCCTGGAGTC -3'
Posted On2014-05-09