Incidental Mutation 'R1663:Rnf213'
ID 186953
Institutional Source Beutler Lab
Gene Symbol Rnf213
Ensembl Gene ENSMUSG00000070327
Gene Name ring finger protein 213
Synonyms D11Ertd759e
MMRRC Submission 039699-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1663 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 119393100-119487418 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 119437672 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1977 (D1977G)
Ref Sequence ENSEMBL: ENSMUSP00000091429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093902] [ENSMUST00000131035]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000093902
AA Change: D1977G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000091429
Gene: ENSMUSG00000070327
AA Change: D1977G

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 676 688 N/A INTRINSIC
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1546 1558 N/A INTRINSIC
AAA 2373 2515 2.82e-2 SMART
AAA 2722 2890 3.63e-1 SMART
low complexity region 3449 3459 N/A INTRINSIC
RING 3947 3985 8.69e-5 SMART
Blast:PP2Ac 4544 4722 3e-66 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000131035
AA Change: D1976G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000115063
Gene: ENSMUSG00000070327
AA Change: D1976G

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 676 688 N/A INTRINSIC
low complexity region 1113 1127 N/A INTRINSIC
low complexity region 1545 1557 N/A INTRINSIC
AAA 2372 2514 2.82e-2 SMART
AAA 2721 2889 3.63e-1 SMART
low complexity region 3448 3458 N/A INTRINSIC
RING 3946 3984 8.69e-5 SMART
Blast:PP2Ac 4542 4720 3e-66 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a C3HC4-type RING finger domain, which is a specialized type of Zn-finger that binds two atoms of zinc and is thought to be involved in mediating protein-protein interactions. The protein also contains an AAA domain, which is associated with ATPase activity. This gene is a susceptibility gene for Moyamoya disease, a vascular disorder of intracranial arteries. This gene is also a translocation partner in anaplastic large cell lymphoma and inflammatory myofibroblastic tumor cases, where a t(2;17)(p23;q25) translocation has been identified with the anaplastic lymphoma kinase (ALK) gene on chromosome 2, and a t(8;17)(q24;q25) translocation has been identified with the MYC gene on chromosome 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and circulating glucose level but normal glucose tolerance, insulin sensitivity, insulin plasma levels and leptin plasma levels. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T A 8: 24,687,933 (GRCm38) T11S probably benign Het
Adgb T C 10: 10,339,675 (GRCm38) M1529V possibly damaging Het
Ankrd36 T A 11: 5,620,126 (GRCm38) D531E possibly damaging Het
Ankzf1 C T 1: 75,196,270 (GRCm38) P337S probably damaging Het
Apc A G 18: 34,268,325 (GRCm38) I55V probably damaging Het
Aplnr A G 2: 85,136,694 (GRCm38) D21G possibly damaging Het
Apol10b A T 15: 77,588,714 (GRCm38) F47I probably damaging Het
Arhgef5 G A 6: 43,276,965 (GRCm38) A1131T probably damaging Het
Arrb2 A T 11: 70,437,603 (GRCm38) Q83L probably damaging Het
Atf7ip A G 6: 136,603,324 (GRCm38) Q1082R possibly damaging Het
Atl2 A G 17: 79,864,711 (GRCm38) S28P probably damaging Het
Brd7 T C 8: 88,358,023 (GRCm38) K89E possibly damaging Het
Cc2d1b A G 4: 108,623,547 (GRCm38) T55A probably damaging Het
Ccdc18 A G 5: 108,216,090 (GRCm38) E1217G probably damaging Het
Cdc42ep4 A T 11: 113,729,451 (GRCm38) M38K probably damaging Het
Cldn14 A G 16: 93,919,278 (GRCm38) S227P probably damaging Het
Clspn T A 4: 126,565,975 (GRCm38) C332S probably benign Het
Col5a1 T C 2: 27,951,476 (GRCm38) S370P unknown Het
Comp T C 8: 70,373,600 (GRCm38) L10P possibly damaging Het
Dcc A T 18: 71,826,052 (GRCm38) N216K probably damaging Het
Dcstamp C T 15: 39,754,944 (GRCm38) Q250* probably null Het
Drd5 T C 5: 38,320,855 (GRCm38) F397S probably benign Het
Dst T C 1: 34,163,385 (GRCm38) S265P probably damaging Het
Enam A T 5: 88,503,994 (GRCm38) S1046C probably damaging Het
Eno3 T C 11: 70,662,274 (GRCm38) probably null Het
Fam13a G A 6: 58,954,372 (GRCm38) R408* probably null Het
Gipc2 T A 3: 152,094,164 (GRCm38) M310L probably benign Het
Gm14496 T C 2: 181,997,437 (GRCm38) V440A probably benign Het
Gzmg A T 14: 56,156,808 (GRCm38) C210S probably damaging Het
Helb G T 10: 120,105,433 (GRCm38) A450E probably damaging Het
Hepacam2 A T 6: 3,483,439 (GRCm38) I190N possibly damaging Het
Hk3 A T 13: 55,006,575 (GRCm38) S773T probably benign Het
Hnrnpc A G 14: 52,075,395 (GRCm38) S221P probably damaging Het
Ifna9 T C 4: 88,591,983 (GRCm38) T135A probably benign Het
Igfn1 C T 1: 135,968,308 (GRCm38) G1507R probably benign Het
Kank3 A G 17: 33,818,375 (GRCm38) T218A probably benign Het
Kcp G T 6: 29,498,965 (GRCm38) R337S possibly damaging Het
Krt74 A T 15: 101,756,674 (GRCm38) noncoding transcript Het
Lrp1 A T 10: 127,556,921 (GRCm38) D2758E probably damaging Het
Ly75 T C 2: 60,314,234 (GRCm38) E1295G probably damaging Het
Mccc1 C A 3: 35,978,933 (GRCm38) W354L probably damaging Het
Mmp1a C T 9: 7,465,656 (GRCm38) T198M probably benign Het
Mtmr2 C T 9: 13,803,501 (GRCm38) T519I probably damaging Het
Nbea A G 3: 55,645,986 (GRCm38) S2632P possibly damaging Het
Nbn T A 4: 15,970,903 (GRCm38) D295E probably benign Het
Ndufb8 T C 19: 44,550,381 (GRCm38) Y167C probably damaging Het
Nisch A G 14: 31,191,521 (GRCm38) probably benign Het
Notch3 C T 17: 32,156,119 (GRCm38) G407D probably damaging Het
Nucb1 A G 7: 45,498,864 (GRCm38) F175S probably damaging Het
Olfr355 T G 2: 36,927,334 (GRCm38) Y260S probably damaging Het
Olfr804 G A 10: 129,705,291 (GRCm38) V138M probably benign Het
Olfr834 T A 9: 18,988,710 (GRCm38) C241S probably damaging Het
Olfr907 T G 9: 38,499,572 (GRCm38) I301R unknown Het
Pip5k1c T C 10: 81,312,515 (GRCm38) V425A probably damaging Het
Pnisr T A 4: 21,873,857 (GRCm38) probably benign Het
Prkag1 A G 15: 98,815,895 (GRCm38) V18A probably damaging Het
Rad50 T C 11: 53,668,223 (GRCm38) N1063S probably benign Het
Rnf170 C T 8: 26,129,143 (GRCm38) H132Y probably damaging Het
Sema3a G A 5: 13,557,125 (GRCm38) probably null Het
Setx T A 2: 29,126,905 (GRCm38) C7S probably damaging Het
Slc23a2 A G 2: 132,065,464 (GRCm38) I417T probably damaging Het
Spink6 T G 18: 44,071,521 (GRCm38) F18C unknown Het
Sptbn1 T C 11: 30,120,783 (GRCm38) Q1538R possibly damaging Het
Strn3 A G 12: 51,652,826 (GRCm38) Y188H probably damaging Het
Tecpr1 C A 5: 144,197,944 (GRCm38) K1040N probably benign Het
Tll1 T A 8: 64,017,686 (GRCm38) Y901F probably benign Het
Tmem81 C T 1: 132,507,897 (GRCm38) A147V probably benign Het
Tnpo3 T C 6: 29,565,759 (GRCm38) D532G probably benign Het
Vmn2r19 T A 6: 123,336,452 (GRCm38) I827N probably benign Het
Wdr35 A G 12: 9,020,000 (GRCm38) K857R probably benign Het
Wdr60 T C 12: 116,229,610 (GRCm38) Q574R probably benign Het
Zfp110 A G 7: 12,848,642 (GRCm38) T406A probably benign Het
Zfp52 T C 17: 21,561,822 (GRCm38) L644P possibly damaging Het
Zfp605 G A 5: 110,127,585 (GRCm38) V190I probably benign Het
Zfp964 A G 8: 69,664,083 (GRCm38) probably null Het
Zmynd8 A G 2: 165,807,885 (GRCm38) S779P probably benign Het
Zswim5 T A 4: 116,986,895 (GRCm38) N1043K probably damaging Het
Other mutations in Rnf213
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Rnf213 APN 11 119,449,343 (GRCm38) missense probably benign 0.00
IGL00961:Rnf213 APN 11 119,440,843 (GRCm38) missense possibly damaging 0.55
IGL01324:Rnf213 APN 11 119,447,237 (GRCm38) missense probably damaging 1.00
IGL01351:Rnf213 APN 11 119,483,118 (GRCm38) missense probably benign 0.25
IGL01403:Rnf213 APN 11 119,443,300 (GRCm38) missense probably damaging 1.00
IGL01704:Rnf213 APN 11 119,449,876 (GRCm38) critical splice donor site probably null
IGL01765:Rnf213 APN 11 119,436,352 (GRCm38) missense probably benign 0.00
IGL01803:Rnf213 APN 11 119,441,307 (GRCm38) missense probably damaging 1.00
IGL01804:Rnf213 APN 11 119,442,266 (GRCm38) missense probably damaging 1.00
IGL01900:Rnf213 APN 11 119,443,015 (GRCm38) missense probably benign 0.05
IGL01944:Rnf213 APN 11 119,416,457 (GRCm38) missense probably benign 0.01
IGL01982:Rnf213 APN 11 119,443,268 (GRCm38) missense probably damaging 1.00
IGL02008:Rnf213 APN 11 119,418,309 (GRCm38) splice site probably benign
IGL02084:Rnf213 APN 11 119,445,673 (GRCm38) missense probably benign 0.04
IGL02253:Rnf213 APN 11 119,440,650 (GRCm38) missense probably benign 0.03
IGL02254:Rnf213 APN 11 119,480,907 (GRCm38) missense possibly damaging 0.89
IGL02296:Rnf213 APN 11 119,463,336 (GRCm38) missense probably benign 0.01
IGL02531:Rnf213 APN 11 119,436,802 (GRCm38) missense probably benign
IGL02588:Rnf213 APN 11 119,416,536 (GRCm38) missense probably benign 0.30
IGL02615:Rnf213 APN 11 119,440,789 (GRCm38) missense probably damaging 0.96
IGL02805:Rnf213 APN 11 119,435,066 (GRCm38) missense probably damaging 0.99
IGL02887:Rnf213 APN 11 119,427,510 (GRCm38) missense probably damaging 1.00
IGL03001:Rnf213 APN 11 119,479,941 (GRCm38) missense probably damaging 1.00
IGL03035:Rnf213 APN 11 119,445,626 (GRCm38) splice site probably benign
IGL03057:Rnf213 APN 11 119,441,087 (GRCm38) missense probably damaging 1.00
IGL03148:Rnf213 APN 11 119,465,007 (GRCm38) missense probably damaging 1.00
IGL03308:Rnf213 APN 11 119,474,172 (GRCm38) missense probably benign 0.03
IGL03339:Rnf213 APN 11 119,443,004 (GRCm38) missense probably damaging 1.00
IGL03369:Rnf213 APN 11 119,421,468 (GRCm38) missense probably benign 0.34
attrition UTSW 11 119,430,321 (GRCm38) missense possibly damaging 0.77
defame UTSW 11 119,430,281 (GRCm38) nonsense probably null
Derogate UTSW 11 119,470,210 (GRCm38) missense probably damaging 1.00
dinky UTSW 11 119,416,458 (GRCm38) missense probably damaging 0.99
G1funyon_rnf213_024 UTSW 11 119,434,742 (GRCm38) missense
Impugn UTSW 11 119,436,823 (GRCm38) nonsense probably null
R4332_Rnf213_642 UTSW 11 119,436,676 (GRCm38) missense probably damaging 1.00
B6584:Rnf213 UTSW 11 119,426,069 (GRCm38) missense probably damaging 0.97
G1Funyon:Rnf213 UTSW 11 119,434,742 (GRCm38) missense
PIT4585001:Rnf213 UTSW 11 119,458,392 (GRCm38) missense
R0008:Rnf213 UTSW 11 119,465,052 (GRCm38) missense possibly damaging 0.82
R0015:Rnf213 UTSW 11 119,441,606 (GRCm38) missense possibly damaging 0.95
R0041:Rnf213 UTSW 11 119,402,575 (GRCm38) missense probably benign 0.41
R0114:Rnf213 UTSW 11 119,414,587 (GRCm38) missense probably damaging 1.00
R0131:Rnf213 UTSW 11 119,430,361 (GRCm38) missense probably benign 0.10
R0131:Rnf213 UTSW 11 119,430,361 (GRCm38) missense probably benign 0.10
R0132:Rnf213 UTSW 11 119,430,361 (GRCm38) missense probably benign 0.10
R0138:Rnf213 UTSW 11 119,416,496 (GRCm38) missense probably benign 0.05
R0144:Rnf213 UTSW 11 119,479,600 (GRCm38) nonsense probably null
R0184:Rnf213 UTSW 11 119,414,521 (GRCm38) missense probably damaging 0.99
R0321:Rnf213 UTSW 11 119,438,105 (GRCm38) nonsense probably null
R0365:Rnf213 UTSW 11 119,426,111 (GRCm38) missense possibly damaging 0.74
R0415:Rnf213 UTSW 11 119,414,469 (GRCm38) missense probably damaging 1.00
R0421:Rnf213 UTSW 11 119,447,257 (GRCm38) missense probably damaging 1.00
R0494:Rnf213 UTSW 11 119,426,012 (GRCm38) missense possibly damaging 0.65
R0494:Rnf213 UTSW 11 119,443,120 (GRCm38) missense probably damaging 1.00
R0549:Rnf213 UTSW 11 119,465,082 (GRCm38) missense probably damaging 1.00
R0577:Rnf213 UTSW 11 119,443,280 (GRCm38) missense probably damaging 1.00
R0605:Rnf213 UTSW 11 119,431,717 (GRCm38) missense probably benign 0.03
R0638:Rnf213 UTSW 11 119,470,210 (GRCm38) missense probably damaging 1.00
R0675:Rnf213 UTSW 11 119,441,834 (GRCm38) missense probably benign 0.28
R0715:Rnf213 UTSW 11 119,441,150 (GRCm38) missense probably damaging 0.97
R0732:Rnf213 UTSW 11 119,441,068 (GRCm38) missense probably damaging 0.99
R0748:Rnf213 UTSW 11 119,473,480 (GRCm38) missense probably damaging 1.00
R0765:Rnf213 UTSW 11 119,423,095 (GRCm38) critical splice donor site probably null
R0890:Rnf213 UTSW 11 119,430,486 (GRCm38) missense possibly damaging 0.94
R0927:Rnf213 UTSW 11 119,414,570 (GRCm38) missense probably benign 0.00
R0940:Rnf213 UTSW 11 119,416,563 (GRCm38) missense probably benign 0.10
R0959:Rnf213 UTSW 11 119,452,581 (GRCm38) missense probably damaging 0.99
R1077:Rnf213 UTSW 11 119,485,998 (GRCm38) splice site probably benign
R1104:Rnf213 UTSW 11 119,477,229 (GRCm38) missense probably benign 0.29
R1141:Rnf213 UTSW 11 119,435,983 (GRCm38) missense probably benign 0.02
R1219:Rnf213 UTSW 11 119,436,177 (GRCm38) missense probably damaging 1.00
R1435:Rnf213 UTSW 11 119,436,005 (GRCm38) missense probably damaging 1.00
R1444:Rnf213 UTSW 11 119,442,400 (GRCm38) missense probably damaging 1.00
R1474:Rnf213 UTSW 11 119,437,750 (GRCm38) missense probably damaging 1.00
R1488:Rnf213 UTSW 11 119,480,889 (GRCm38) missense probably benign 0.05
R1523:Rnf213 UTSW 11 119,441,888 (GRCm38) missense probably damaging 1.00
R1548:Rnf213 UTSW 11 119,442,707 (GRCm38) missense probably damaging 1.00
R1554:Rnf213 UTSW 11 119,441,839 (GRCm38) missense probably benign 0.06
R1563:Rnf213 UTSW 11 119,414,526 (GRCm38) missense probably benign 0.13
R1572:Rnf213 UTSW 11 119,436,611 (GRCm38) missense probably damaging 1.00
R1585:Rnf213 UTSW 11 119,463,345 (GRCm38) missense probably damaging 1.00
R1635:Rnf213 UTSW 11 119,442,579 (GRCm38) missense probably damaging 0.97
R1789:Rnf213 UTSW 11 119,440,221 (GRCm38) missense probably damaging 0.97
R1844:Rnf213 UTSW 11 119,441,183 (GRCm38) missense probably damaging 1.00
R1871:Rnf213 UTSW 11 119,450,129 (GRCm38) missense probably benign 0.08
R1893:Rnf213 UTSW 11 119,416,448 (GRCm38) missense probably damaging 1.00
R1937:Rnf213 UTSW 11 119,431,685 (GRCm38) missense probably damaging 1.00
R1967:Rnf213 UTSW 11 119,480,895 (GRCm38) missense probably damaging 1.00
R1987:Rnf213 UTSW 11 119,441,107 (GRCm38) missense probably damaging 1.00
R2000:Rnf213 UTSW 11 119,436,022 (GRCm38) missense probably damaging 1.00
R2020:Rnf213 UTSW 11 119,461,918 (GRCm38) missense probably damaging 0.99
R2100:Rnf213 UTSW 11 119,467,302 (GRCm38) nonsense probably null
R2109:Rnf213 UTSW 11 119,442,663 (GRCm38) nonsense probably null
R2115:Rnf213 UTSW 11 119,428,013 (GRCm38) missense probably benign 0.00
R2126:Rnf213 UTSW 11 119,450,201 (GRCm38) missense probably damaging 0.99
R2144:Rnf213 UTSW 11 119,443,690 (GRCm38) missense probably damaging 0.99
R2145:Rnf213 UTSW 11 119,415,193 (GRCm38) missense probably benign 0.03
R2168:Rnf213 UTSW 11 119,415,070 (GRCm38) missense probably damaging 0.97
R2189:Rnf213 UTSW 11 119,430,361 (GRCm38) missense probably benign 0.10
R2199:Rnf213 UTSW 11 119,460,009 (GRCm38) missense probably benign 0.01
R2220:Rnf213 UTSW 11 119,436,428 (GRCm38) missense possibly damaging 0.94
R2336:Rnf213 UTSW 11 119,414,604 (GRCm38) missense probably benign 0.02
R2400:Rnf213 UTSW 11 119,443,195 (GRCm38) missense probably damaging 1.00
R2679:Rnf213 UTSW 11 119,459,938 (GRCm38) splice site probably null
R2698:Rnf213 UTSW 11 119,410,144 (GRCm38) missense probably benign 0.26
R3151:Rnf213 UTSW 11 119,468,892 (GRCm38) missense probably benign 0.03
R3607:Rnf213 UTSW 11 119,441,976 (GRCm38) nonsense probably null
R3808:Rnf213 UTSW 11 119,479,558 (GRCm38) missense probably damaging 1.00
R3854:Rnf213 UTSW 11 119,480,939 (GRCm38) splice site probably benign
R3856:Rnf213 UTSW 11 119,480,939 (GRCm38) splice site probably benign
R3973:Rnf213 UTSW 11 119,469,053 (GRCm38) missense
R4014:Rnf213 UTSW 11 119,445,729 (GRCm38) nonsense probably null
R4049:Rnf213 UTSW 11 119,482,448 (GRCm38) missense possibly damaging 0.67
R4130:Rnf213 UTSW 11 119,483,006 (GRCm38) missense probably damaging 1.00
R4153:Rnf213 UTSW 11 119,409,482 (GRCm38) missense probably benign 0.27
R4167:Rnf213 UTSW 11 119,441,243 (GRCm38) missense probably damaging 0.99
R4224:Rnf213 UTSW 11 119,436,823 (GRCm38) nonsense probably null
R4332:Rnf213 UTSW 11 119,436,676 (GRCm38) missense probably damaging 1.00
R4415:Rnf213 UTSW 11 119,483,964 (GRCm38) missense probably damaging 0.99
R4547:Rnf213 UTSW 11 119,479,670 (GRCm38) critical splice donor site probably null
R4609:Rnf213 UTSW 11 119,437,695 (GRCm38) missense possibly damaging 0.86
R4684:Rnf213 UTSW 11 119,441,125 (GRCm38) missense probably damaging 1.00
R4704:Rnf213 UTSW 11 119,440,349 (GRCm38) missense probably damaging 1.00
R4719:Rnf213 UTSW 11 119,420,067 (GRCm38) missense probably benign 0.38
R4751:Rnf213 UTSW 11 119,445,745 (GRCm38) missense probably benign 0.12
R4828:Rnf213 UTSW 11 119,416,629 (GRCm38) missense possibly damaging 0.61
R4837:Rnf213 UTSW 11 119,442,763 (GRCm38) missense probably benign 0.00
R4894:Rnf213 UTSW 11 119,481,240 (GRCm38) missense probably damaging 1.00
R4973:Rnf213 UTSW 11 119,428,157 (GRCm38) missense possibly damaging 0.84
R5026:Rnf213 UTSW 11 119,436,764 (GRCm38) missense probably damaging 1.00
R5034:Rnf213 UTSW 11 119,410,807 (GRCm38) missense probably damaging 0.99
R5284:Rnf213 UTSW 11 119,458,866 (GRCm38) missense possibly damaging 0.89
R5295:Rnf213 UTSW 11 119,440,816 (GRCm38) missense probably benign 0.00
R5406:Rnf213 UTSW 11 119,440,808 (GRCm38) missense probably damaging 1.00
R5441:Rnf213 UTSW 11 119,409,020 (GRCm38) missense probably damaging 0.99
R5449:Rnf213 UTSW 11 119,415,076 (GRCm38) missense probably benign 0.44
R5520:Rnf213 UTSW 11 119,433,499 (GRCm38) missense probably damaging 1.00
R5636:Rnf213 UTSW 11 119,436,905 (GRCm38) missense probably damaging 1.00
R5636:Rnf213 UTSW 11 119,436,629 (GRCm38) missense probably benign 0.04
R5669:Rnf213 UTSW 11 119,458,785 (GRCm38) missense possibly damaging 0.92
R5670:Rnf213 UTSW 11 119,434,686 (GRCm38) critical splice acceptor site probably null
R5697:Rnf213 UTSW 11 119,483,894 (GRCm38) missense possibly damaging 0.54
R5726:Rnf213 UTSW 11 119,416,458 (GRCm38) missense probably damaging 0.99
R5808:Rnf213 UTSW 11 119,436,295 (GRCm38) missense probably benign
R5861:Rnf213 UTSW 11 119,473,377 (GRCm38) missense probably damaging 1.00
R5903:Rnf213 UTSW 11 119,421,369 (GRCm38) missense probably damaging 0.98
R5949:Rnf213 UTSW 11 119,443,079 (GRCm38) missense probably damaging 1.00
R6022:Rnf213 UTSW 11 119,486,010 (GRCm38) missense probably benign 0.00
R6043:Rnf213 UTSW 11 119,442,101 (GRCm38) missense probably damaging 0.97
R6089:Rnf213 UTSW 11 119,416,559 (GRCm38) missense probably benign 0.14
R6123:Rnf213 UTSW 11 119,411,513 (GRCm38) missense probably damaging 0.96
R6134:Rnf213 UTSW 11 119,411,470 (GRCm38) missense probably damaging 0.99
R6135:Rnf213 UTSW 11 119,442,028 (GRCm38) missense probably benign 0.02
R6146:Rnf213 UTSW 11 119,435,999 (GRCm38) missense probably benign 0.41
R6163:Rnf213 UTSW 11 119,458,428 (GRCm38) missense possibly damaging 0.86
R6272:Rnf213 UTSW 11 119,414,548 (GRCm38) missense probably damaging 1.00
R6333:Rnf213 UTSW 11 119,463,366 (GRCm38) missense probably damaging 1.00
R6370:Rnf213 UTSW 11 119,477,078 (GRCm38) missense probably damaging 0.99
R6456:Rnf213 UTSW 11 119,459,966 (GRCm38) missense probably benign 0.03
R6468:Rnf213 UTSW 11 119,452,687 (GRCm38) missense possibly damaging 0.94
R6579:Rnf213 UTSW 11 119,436,280 (GRCm38) missense probably damaging 0.96
R6648:Rnf213 UTSW 11 119,479,920 (GRCm38) missense possibly damaging 0.81
R6727:Rnf213 UTSW 11 119,430,321 (GRCm38) missense possibly damaging 0.77
R6739:Rnf213 UTSW 11 119,442,271 (GRCm38) missense probably damaging 1.00
R6768:Rnf213 UTSW 11 119,442,236 (GRCm38) missense probably damaging 0.99
R6817:Rnf213 UTSW 11 119,462,285 (GRCm38) critical splice donor site probably null
R6820:Rnf213 UTSW 11 119,448,838 (GRCm38) missense probably damaging 1.00
R6841:Rnf213 UTSW 11 119,449,866 (GRCm38) missense probably benign 0.26
R6934:Rnf213 UTSW 11 119,420,067 (GRCm38) missense probably benign 0.38
R7026:Rnf213 UTSW 11 119,479,655 (GRCm38) missense possibly damaging 0.58
R7094:Rnf213 UTSW 11 119,437,604 (GRCm38) splice site probably null
R7170:Rnf213 UTSW 11 119,452,575 (GRCm38) missense
R7185:Rnf213 UTSW 11 119,424,198 (GRCm38) missense
R7239:Rnf213 UTSW 11 119,458,788 (GRCm38) missense
R7258:Rnf213 UTSW 11 119,452,575 (GRCm38) missense
R7259:Rnf213 UTSW 11 119,452,575 (GRCm38) missense
R7260:Rnf213 UTSW 11 119,452,575 (GRCm38) missense
R7273:Rnf213 UTSW 11 119,431,756 (GRCm38) splice site probably null
R7282:Rnf213 UTSW 11 119,437,992 (GRCm38) missense
R7311:Rnf213 UTSW 11 119,416,547 (GRCm38) missense
R7352:Rnf213 UTSW 11 119,443,579 (GRCm38) missense
R7369:Rnf213 UTSW 11 119,430,468 (GRCm38) missense
R7410:Rnf213 UTSW 11 119,435,051 (GRCm38) missense
R7448:Rnf213 UTSW 11 119,481,291 (GRCm38) missense
R7561:Rnf213 UTSW 11 119,441,719 (GRCm38) missense
R7573:Rnf213 UTSW 11 119,458,484 (GRCm38) missense
R7615:Rnf213 UTSW 11 119,467,297 (GRCm38) missense
R7680:Rnf213 UTSW 11 119,479,556 (GRCm38) missense
R7739:Rnf213 UTSW 11 119,410,861 (GRCm38) missense
R7789:Rnf213 UTSW 11 119,470,219 (GRCm38) splice site probably null
R7806:Rnf213 UTSW 11 119,411,545 (GRCm38) missense
R8031:Rnf213 UTSW 11 119,430,281 (GRCm38) nonsense probably null
R8042:Rnf213 UTSW 11 119,441,654 (GRCm38) missense
R8053:Rnf213 UTSW 11 119,402,647 (GRCm38) missense
R8284:Rnf213 UTSW 11 119,428,083 (GRCm38) missense
R8301:Rnf213 UTSW 11 119,434,742 (GRCm38) missense
R8325:Rnf213 UTSW 11 119,430,445 (GRCm38) missense
R8332:Rnf213 UTSW 11 119,483,698 (GRCm38) missense
R8443:Rnf213 UTSW 11 119,449,323 (GRCm38) missense
R8518:Rnf213 UTSW 11 119,462,217 (GRCm38) missense
R8531:Rnf213 UTSW 11 119,474,205 (GRCm38) missense probably benign 0.02
R8670:Rnf213 UTSW 11 119,458,737 (GRCm38) missense
R8675:Rnf213 UTSW 11 119,456,158 (GRCm38) missense
R8690:Rnf213 UTSW 11 119,441,212 (GRCm38) missense
R8690:Rnf213 UTSW 11 119,418,129 (GRCm38) missense
R8714:Rnf213 UTSW 11 119,468,894 (GRCm38) missense
R8802:Rnf213 UTSW 11 119,462,102 (GRCm38) missense
R8861:Rnf213 UTSW 11 119,442,236 (GRCm38) missense
R8886:Rnf213 UTSW 11 119,473,438 (GRCm38) missense
R8893:Rnf213 UTSW 11 119,443,042 (GRCm38) missense
R8937:Rnf213 UTSW 11 119,430,274 (GRCm38) missense possibly damaging 0.94
R8941:Rnf213 UTSW 11 119,414,424 (GRCm38) missense probably damaging 1.00
R8973:Rnf213 UTSW 11 119,461,930 (GRCm38) missense
R8983:Rnf213 UTSW 11 119,430,349 (GRCm38) missense
R9043:Rnf213 UTSW 11 119,458,913 (GRCm38) missense
R9081:Rnf213 UTSW 11 119,466,236 (GRCm38) missense
R9132:Rnf213 UTSW 11 119,483,916 (GRCm38) missense
R9135:Rnf213 UTSW 11 119,408,747 (GRCm38) missense
R9146:Rnf213 UTSW 11 119,443,673 (GRCm38) missense
R9156:Rnf213 UTSW 11 119,440,748 (GRCm38) missense
R9183:Rnf213 UTSW 11 119,427,622 (GRCm38) missense
R9234:Rnf213 UTSW 11 119,450,117 (GRCm38) missense
R9275:Rnf213 UTSW 11 119,435,942 (GRCm38) missense
R9278:Rnf213 UTSW 11 119,435,942 (GRCm38) missense
R9296:Rnf213 UTSW 11 119,443,795 (GRCm38) splice site probably benign
R9350:Rnf213 UTSW 11 119,442,149 (GRCm38) missense
R9366:Rnf213 UTSW 11 119,436,231 (GRCm38) missense
R9413:Rnf213 UTSW 11 119,466,233 (GRCm38) missense
R9444:Rnf213 UTSW 11 119,434,797 (GRCm38) missense
R9464:Rnf213 UTSW 11 119,463,580 (GRCm38) missense
R9605:Rnf213 UTSW 11 119,469,053 (GRCm38) missense
R9649:Rnf213 UTSW 11 119,479,631 (GRCm38) missense
R9651:Rnf213 UTSW 11 119,440,412 (GRCm38) missense
R9664:Rnf213 UTSW 11 119,441,968 (GRCm38) missense
R9696:Rnf213 UTSW 11 119,468,980 (GRCm38) missense
R9710:Rnf213 UTSW 11 119,441,005 (GRCm38) missense
R9797:Rnf213 UTSW 11 119,442,539 (GRCm38) missense
S24628:Rnf213 UTSW 11 119,414,469 (GRCm38) missense probably damaging 1.00
X0021:Rnf213 UTSW 11 119,441,824 (GRCm38) missense probably benign 0.14
X0062:Rnf213 UTSW 11 119,473,513 (GRCm38) missense probably benign 0.05
X0064:Rnf213 UTSW 11 119,440,463 (GRCm38) missense probably damaging 1.00
Z1088:Rnf213 UTSW 11 119,477,254 (GRCm38) missense possibly damaging 0.69
Z1176:Rnf213 UTSW 11 119,482,998 (GRCm38) missense
Z1176:Rnf213 UTSW 11 119,441,410 (GRCm38) missense
Predicted Primers PCR Primer
(F):5'- TGCGCCGTCAGTAGTCAGGAAAAG -3'
(R):5'- TACAGAGCTGCTTGTTTGCCCC -3'

Sequencing Primer
(F):5'- CATGGTTAATGAAGCTGCTAAGAAG -3'
(R):5'- TTGCCCCTTGACAGGATG -3'
Posted On 2014-05-09