Incidental Mutation 'R1663:Ndufb8'
ID186974
Institutional Source Beutler Lab
Gene Symbol Ndufb8
Ensembl Gene ENSMUSG00000025204
Gene NameNADH dehydrogenase (ubiquinone) 1 beta subcomplex 8
Synonyms
MMRRC Submission 039699-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1663 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location44548572-44555440 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44550381 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 167 (Y167C)
Ref Sequence ENSEMBL: ENSMUSP00000026222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026222] [ENSMUST00000063632] [ENSMUST00000111985] [ENSMUST00000167027] [ENSMUST00000168083] [ENSMUST00000169304] [ENSMUST00000171415]
Predicted Effect probably damaging
Transcript: ENSMUST00000026222
AA Change: Y167C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026222
Gene: ENSMUSG00000025204
AA Change: Y167C

DomainStartEndE-ValueType
low complexity region 2 8 N/A INTRINSIC
Pfam:NDUF_B8 15 186 1.1e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063632
SMART Domains Protein: ENSMUSP00000064900
Gene: ENSMUSG00000051984

DomainStartEndE-ValueType
Blast:WD40 56 101 5e-18 BLAST
WD40 110 150 4.76e-6 SMART
WD40 159 197 1.53e1 SMART
WD40 200 245 1.85e0 SMART
WD40 249 289 2.15e-4 SMART
WD40 292 332 6.19e-1 SMART
low complexity region 551 561 N/A INTRINSIC
low complexity region 822 841 N/A INTRINSIC
low complexity region 909 929 N/A INTRINSIC
low complexity region 1009 1018 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111985
SMART Domains Protein: ENSMUSP00000107616
Gene: ENSMUSG00000051984

DomainStartEndE-ValueType
WD40 2 40 1.53e1 SMART
WD40 43 88 1.85e0 SMART
WD40 92 132 2.15e-4 SMART
WD40 135 175 6.19e-1 SMART
Pfam:Sec16_C 394 612 1.3e-7 PFAM
low complexity region 665 684 N/A INTRINSIC
low complexity region 752 772 N/A INTRINSIC
low complexity region 852 861 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164543
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166557
Predicted Effect probably benign
Transcript: ENSMUST00000166808
SMART Domains Protein: ENSMUSP00000126763
Gene: ENSMUSG00000091471

DomainStartEndE-ValueType
Pfam:NDUF_B8 1 71 1.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167027
SMART Domains Protein: ENSMUSP00000130918
Gene: ENSMUSG00000025204

DomainStartEndE-ValueType
low complexity region 2 8 N/A INTRINSIC
Pfam:NDUF_B8 54 139 2.4e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168083
SMART Domains Protein: ENSMUSP00000132740
Gene: ENSMUSG00000025204

DomainStartEndE-ValueType
low complexity region 2 8 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168474
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169181
Predicted Effect probably benign
Transcript: ENSMUST00000169304
SMART Domains Protein: ENSMUSP00000132421
Gene: ENSMUSG00000025204

DomainStartEndE-ValueType
Pfam:NDUF_B8 1 108 4e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171415
SMART Domains Protein: ENSMUSP00000128192
Gene: ENSMUSG00000025204

DomainStartEndE-ValueType
low complexity region 2 8 N/A INTRINSIC
Pfam:NDUF_B8 15 157 2.9e-67 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T A 8: 24,687,933 T11S probably benign Het
Adgb T C 10: 10,339,675 M1529V possibly damaging Het
Ankrd36 T A 11: 5,620,126 D531E possibly damaging Het
Ankzf1 C T 1: 75,196,270 P337S probably damaging Het
Apc A G 18: 34,268,325 I55V probably damaging Het
Aplnr A G 2: 85,136,694 D21G possibly damaging Het
Apol10b A T 15: 77,588,714 F47I probably damaging Het
Arhgef5 G A 6: 43,276,965 A1131T probably damaging Het
Arrb2 A T 11: 70,437,603 Q83L probably damaging Het
Atf7ip A G 6: 136,603,324 Q1082R possibly damaging Het
Atl2 A G 17: 79,864,711 S28P probably damaging Het
Brd7 T C 8: 88,358,023 K89E possibly damaging Het
Cc2d1b A G 4: 108,623,547 T55A probably damaging Het
Ccdc18 A G 5: 108,216,090 E1217G probably damaging Het
Cdc42ep4 A T 11: 113,729,451 M38K probably damaging Het
Cldn14 A G 16: 93,919,278 S227P probably damaging Het
Clspn T A 4: 126,565,975 C332S probably benign Het
Col5a1 T C 2: 27,951,476 S370P unknown Het
Comp T C 8: 70,373,600 L10P possibly damaging Het
Dcc A T 18: 71,826,052 N216K probably damaging Het
Dcstamp C T 15: 39,754,944 Q250* probably null Het
Drd5 T C 5: 38,320,855 F397S probably benign Het
Dst T C 1: 34,163,385 S265P probably damaging Het
Enam A T 5: 88,503,994 S1046C probably damaging Het
Eno3 T C 11: 70,662,274 probably null Het
Fam13a G A 6: 58,954,372 R408* probably null Het
Gipc2 T A 3: 152,094,164 M310L probably benign Het
Gm14496 T C 2: 181,997,437 V440A probably benign Het
Gzmg A T 14: 56,156,808 C210S probably damaging Het
Helb G T 10: 120,105,433 A450E probably damaging Het
Hepacam2 A T 6: 3,483,439 I190N possibly damaging Het
Hk3 A T 13: 55,006,575 S773T probably benign Het
Hnrnpc A G 14: 52,075,395 S221P probably damaging Het
Ifna9 T C 4: 88,591,983 T135A probably benign Het
Igfn1 C T 1: 135,968,308 G1507R probably benign Het
Kank3 A G 17: 33,818,375 T218A probably benign Het
Kcp G T 6: 29,498,965 R337S possibly damaging Het
Krt74 A T 15: 101,756,674 noncoding transcript Het
Lrp1 A T 10: 127,556,921 D2758E probably damaging Het
Ly75 T C 2: 60,314,234 E1295G probably damaging Het
Mccc1 C A 3: 35,978,933 W354L probably damaging Het
Mmp1a C T 9: 7,465,656 T198M probably benign Het
Mtmr2 C T 9: 13,803,501 T519I probably damaging Het
Nbea A G 3: 55,645,986 S2632P possibly damaging Het
Nbn T A 4: 15,970,903 D295E probably benign Het
Nisch A G 14: 31,191,521 probably benign Het
Notch3 C T 17: 32,156,119 G407D probably damaging Het
Nucb1 A G 7: 45,498,864 F175S probably damaging Het
Olfr355 T G 2: 36,927,334 Y260S probably damaging Het
Olfr804 G A 10: 129,705,291 V138M probably benign Het
Olfr834 T A 9: 18,988,710 C241S probably damaging Het
Olfr907 T G 9: 38,499,572 I301R unknown Het
Pip5k1c T C 10: 81,312,515 V425A probably damaging Het
Pnisr T A 4: 21,873,857 probably benign Het
Prkag1 A G 15: 98,815,895 V18A probably damaging Het
Rad50 T C 11: 53,668,223 N1063S probably benign Het
Rnf170 C T 8: 26,129,143 H132Y probably damaging Het
Rnf213 A G 11: 119,437,672 D1977G probably benign Het
Sema3a G A 5: 13,557,125 probably null Het
Setx T A 2: 29,126,905 C7S probably damaging Het
Slc23a2 A G 2: 132,065,464 I417T probably damaging Het
Spink6 T G 18: 44,071,521 F18C unknown Het
Sptbn1 T C 11: 30,120,783 Q1538R possibly damaging Het
Strn3 A G 12: 51,652,826 Y188H probably damaging Het
Tecpr1 C A 5: 144,197,944 K1040N probably benign Het
Tll1 T A 8: 64,017,686 Y901F probably benign Het
Tmem81 C T 1: 132,507,897 A147V probably benign Het
Tnpo3 T C 6: 29,565,759 D532G probably benign Het
Vmn2r19 T A 6: 123,336,452 I827N probably benign Het
Wdr35 A G 12: 9,020,000 K857R probably benign Het
Wdr60 T C 12: 116,229,610 Q574R probably benign Het
Zfp110 A G 7: 12,848,642 T406A probably benign Het
Zfp52 T C 17: 21,561,822 L644P possibly damaging Het
Zfp605 G A 5: 110,127,585 V190I probably benign Het
Zfp964 A G 8: 69,664,083 probably null Het
Zmynd8 A G 2: 165,807,885 S779P probably benign Het
Zswim5 T A 4: 116,986,895 N1043K probably damaging Het
Other mutations in Ndufb8
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0463:Ndufb8 UTSW 19 44550345 missense possibly damaging 0.82
R0608:Ndufb8 UTSW 19 44550345 missense possibly damaging 0.82
R1637:Ndufb8 UTSW 19 44555035 missense probably benign 0.20
R2099:Ndufb8 UTSW 19 44555310 splice site probably benign
R4287:Ndufb8 UTSW 19 44552691 missense probably benign 0.12
R6088:Ndufb8 UTSW 19 44555025 missense probably benign 0.00
R6494:Ndufb8 UTSW 19 44555305 missense probably null
R7376:Ndufb8 UTSW 19 44555355 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCCATCCTTCCAATTTCAGAGCAGG -3'
(R):5'- TTGAGCATGGCAAGAGCATCCC -3'

Sequencing Primer
(F):5'- GATCCTCACAGCAGTGACTATTC -3'
(R):5'- GCAAGAGCATCCCTCTGC -3'
Posted On2014-05-09