Mutagenetix > Incidental Mutation

Incidental Mutation 'R1664:Col24a1'

186995

Institutional Source

Beutler Lab

Gene Symbol

Col24a1

Ensembl Gene

ENSMUSG00000028197

Gene Name

collagen, type XXIV, alpha 1

Synonyms

5430404K19Rik

MMRRC Submission

039700-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1664 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

145292472-145552011 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

G to A at 145389600 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000029848 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029848]

AlphaFold

Q30D77

Predicted Effect

probably null
Transcript: ENSMUST00000029848

SMART Domains

Protein: ENSMUSP00000029848
Gene: ENSMUSG00000028197

Domain	Start	End	E-Value	Type
transmembrane domain	21	40	N/A	INTRINSIC
TSPN	41	230	2.7e-3	SMART
LamG	106	229	8.07e-2	SMART
Pfam:Collagen	506	565	9.6e-10	PFAM
Pfam:Collagen	561	623	3.4e-10	PFAM
Pfam:Collagen	604	678	2.3e-9	PFAM
low complexity region	682	724	N/A	INTRINSIC
Pfam:Collagen	772	837	1.3e-10	PFAM
Pfam:Collagen	865	938	6e-9	PFAM
Pfam:Collagen	967	1042	3.1e-8	PFAM
low complexity region	1056	1075	N/A	INTRINSIC
Pfam:Collagen	1107	1180	8e-9	PFAM
Pfam:Collagen	1159	1218	4.2e-10	PFAM
Pfam:Collagen	1218	1279	1.8e-10	PFAM
Pfam:Collagen	1270	1334	3.1e-9	PFAM
Pfam:Collagen	1378	1443	1.3e-9	PFAM
Pfam:Collagen	1439	1500	1.8e-9	PFAM
COLFI	1533	1733	9.34e-34	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.0%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes the alpha-1 subunit of type XXIV collagen, one of the low abundance fibril-forming collagens found in cartilage. The encoded protein has structural features of invertebrate fibrillar collagens and is expressed predominantly in bone tissue. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	T	A	17: 33,066,518	I437F	probably damaging	Het
4930596D02Rik	T	A	14: 35,811,815	T45S	probably benign	Het
Ackr1	A	G	1: 173,332,866	F29L	probably benign	Het
Adgrf2	T	A	17: 42,714,414	S60C	possibly damaging	Het
Alpk2	A	G	18: 65,349,873	C355R	probably damaging	Het
Ankmy1	A	C	1: 92,885,191	D465E	probably benign	Het
Ankrd27	T	A	7: 35,607,126	D310E	probably damaging	Het
Ap3d1	G	A	10: 80,717,737	Q559*	probably null	Het
C4b	T	C	17: 34,732,978	T1298A	probably damaging	Het
Casr	T	A	16: 36,509,965	K336*	probably null	Het
Ccdc116	A	T	16: 17,142,628	D108E	probably benign	Het
Ccr7	A	T	11: 99,145,691	I135N	possibly damaging	Het
Cd96	A	G	16: 46,118,001	Y34H	possibly damaging	Het
Cdan1	T	A	2: 120,720,506	D1135V	probably damaging	Het
Cecr2	C	A	6: 120,762,026	T1210K	probably damaging	Het
Cep152	C	A	2: 125,566,254	A1390S	probably benign	Het
Chd9	T	G	8: 91,022,790		probably null	Het
Cntnap5c	G	T	17: 58,293,990	W776L	probably benign	Het
Cpa2	G	T	6: 30,554,315	M311I	probably damaging	Het
Cpz	A	G	5: 35,506,743	F483L	probably damaging	Het
Ddx19a	A	C	8: 110,989,498	V90G	probably damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fbxw7	A	G	3: 84,969,171	D213G	possibly damaging	Het
Fgd2	T	C	17: 29,369,299	F362L	probably damaging	Het
Fryl	A	G	5: 73,059,435	Y2171H	probably damaging	Het
Gba2	T	C	4: 43,578,080	R90G	probably benign	Het
Gm10073	T	C	8: 106,573,232	E40G	probably damaging	Het
Gm8251	T	A	1: 44,059,227	I904F	possibly damaging	Het
Grhl3	T	C	4: 135,552,550	I398V	probably benign	Het
Grip2	T	A	6: 91,765,252	H899L	probably damaging	Het
Grk2	T	C	19: 4,287,240	K644E	possibly damaging	Het
Iars	A	T	13: 49,711,775	T576S	probably damaging	Het
Kif26b	G	A	1: 178,932,139	V2084M	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lrrc69	G	A	4: 14,775,079	T63M	probably damaging	Het
Lrrn4	A	T	2: 132,869,966	C646S	probably damaging	Het
Mtf2	C	T	5: 108,104,476	T457M	probably damaging	Het
Ncln	A	T	10: 81,487,721	C531S	probably benign	Het
Ntn4	C	T	10: 93,707,353	R314W	probably damaging	Het
Olfr110	C	T	17: 37,499,425	T258M	possibly damaging	Het
Olfr251	A	T	9: 38,378,252	M124L	possibly damaging	Het
Olfr761	T	C	17: 37,952,893	I44V	probably benign	Het
Otogl	A	G	10: 107,806,576	V1331A	probably benign	Het
Palb2	A	G	7: 122,124,392		probably benign	Het
Pcdh20	T	C	14: 88,468,322	E514G	possibly damaging	Het
Pclaf	A	G	9: 65,890,448	N7S	probably benign	Het
Pdrg1	C	T	2: 153,015,328		probably benign	Het
Pik3r6	T	A	11: 68,536,106	D464E	probably benign	Het
Pkp3	A	G	7: 141,087,647	N454D	probably damaging	Het
Plekha7	C	A	7: 116,135,034		probably null	Het
Ppip5k1	A	G	2: 121,337,182	V784A	probably benign	Het
Ppp1r36	T	A	12: 76,436,254	D205E	possibly damaging	Het
Prss35	A	T	9: 86,755,647	T157S	probably benign	Het
Ptprn2	T	C	12: 117,161,709	L621P	probably damaging	Het
Rasgrp3	A	G	17: 75,524,177	K524R	probably damaging	Het
Rasgrp4	T	A	7: 29,140,263	H133Q	probably benign	Het
Reln	A	T	5: 21,929,086	Y2615N	probably damaging	Het
Rpf1	T	A	3: 146,512,148	T204S	probably benign	Het
Scgb2b3	T	A	7: 31,359,039	*113L	probably null	Het
Scn5a	A	C	9: 119,521,177	L877R	possibly damaging	Het
Sh3pxd2a	A	T	19: 47,268,382	D632E	probably benign	Het
Slc39a10	T	C	1: 46,826,109	H522R	probably damaging	Het
Spink2	A	T	5: 77,207,008	C19S	probably damaging	Het
Spsb4	A	G	9: 96,996,213	L19P	possibly damaging	Het
St7l	T	C	3: 104,870,898	V117A	probably damaging	Het
Stac2	C	T	11: 98,042,594	S174N	probably damaging	Het
Sult4a1	A	G	15: 84,086,617	Y196H	probably benign	Het
Tex2	C	T	11: 106,567,782		probably benign	Het
Tprgl	A	T	4: 154,159,405	V98D	possibly damaging	Het
Ttn	G	A	2: 76,718,025	H31978Y	probably damaging	Het
Ttn	T	C	2: 76,828,509		probably benign	Het
Tyk2	C	A	9: 21,120,353	R447L	probably damaging	Het
Ucn3	T	C	13: 3,941,634	Y6C	possibly damaging	Het
Urb1	A	T	16: 90,788,082		probably null	Het
Vmn2r94	G	C	17: 18,244,144	A628G	probably damaging	Het
Wdr95	C	A	5: 149,595,287	T389K	probably damaging	Het
Wrn	A	T	8: 33,280,766		probably null	Het
Xab2	T	A	8: 3,619,068		probably null	Het
Zfp458	A	T	13: 67,258,080	N95K	possibly damaging	Het
Zfp672	T	C	11: 58,317,312	H61R	probably damaging	Het
Zfp942	C	T	17: 21,928,439	G403E	possibly damaging	Het

Other mutations in Col24a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00841:Col24a1	APN	3	145362309	missense	probably damaging	1.00
IGL00931:Col24a1	APN	3	145461470	missense	probably benign	0.00
IGL01160:Col24a1	APN	3	145507713	missense	probably damaging	1.00
IGL01355:Col24a1	APN	3	145314876	missense	probably benign	0.07
IGL01409:Col24a1	APN	3	145538564	missense	probably benign	0.19
IGL01587:Col24a1	APN	3	145433355	splice site	probably null
IGL01666:Col24a1	APN	3	145344686	missense	possibly damaging	0.93
IGL01717:Col24a1	APN	3	145524263	splice site	probably benign
IGL01721:Col24a1	APN	3	145538567	missense	probably benign	0.26
IGL01939:Col24a1	APN	3	145315244	missense	probably damaging	1.00
IGL01988:Col24a1	APN	3	145524167	splice site	probably null
IGL02002:Col24a1	APN	3	145356944	missense	possibly damaging	0.81
IGL02172:Col24a1	APN	3	145314962	missense	probably benign	0.34
IGL02552:Col24a1	APN	3	145474207	missense	possibly damaging	0.88
IGL02559:Col24a1	APN	3	145314173	missense	probably benign
IGL02582:Col24a1	APN	3	145314486	missense	probably damaging	1.00
IGL02652:Col24a1	APN	3	145492301	nonsense	probably null
IGL02942:Col24a1	APN	3	145541665	missense	probably damaging	1.00
IGL03032:Col24a1	APN	3	145538703	critical splice donor site	probably null
IGL03108:Col24a1	APN	3	145323401	missense	probably damaging	1.00
IGL03310:Col24a1	APN	3	145313983	splice site	probably benign
IGL03405:Col24a1	APN	3	145315157	missense	possibly damaging	0.73
R0066:Col24a1	UTSW	3	145545144	missense	probably damaging	1.00
R0066:Col24a1	UTSW	3	145545144	missense	probably damaging	1.00
R0379:Col24a1	UTSW	3	145524142	missense	possibly damaging	0.94
R0502:Col24a1	UTSW	3	145545316	splice site	probably benign
R0556:Col24a1	UTSW	3	145314728	missense	possibly damaging	0.53
R0587:Col24a1	UTSW	3	145293145	missense	possibly damaging	0.50
R0617:Col24a1	UTSW	3	145314120	missense	probably damaging	1.00
R0831:Col24a1	UTSW	3	145328759	missense	probably damaging	1.00
R1455:Col24a1	UTSW	3	145460838	missense	probably damaging	1.00
R1713:Col24a1	UTSW	3	145366869	nonsense	probably null
R1854:Col24a1	UTSW	3	145459140	missense	probably damaging	1.00
R1855:Col24a1	UTSW	3	145459140	missense	probably damaging	1.00
R1861:Col24a1	UTSW	3	145537267	critical splice donor site	probably null
R1969:Col24a1	UTSW	3	145314930	missense	probably benign	0.03
R2216:Col24a1	UTSW	3	145314981	missense	probably benign	0.34
R2290:Col24a1	UTSW	3	145513195	missense	probably damaging	1.00
R3702:Col24a1	UTSW	3	145337860	missense	probably benign	0.01
R3772:Col24a1	UTSW	3	145545286	missense	probably damaging	1.00
R4086:Col24a1	UTSW	3	145461437	missense	probably damaging	1.00
R4236:Col24a1	UTSW	3	145524282	nonsense	probably null
R4433:Col24a1	UTSW	3	145314383	missense	possibly damaging	0.95
R4688:Col24a1	UTSW	3	145314383	missense	probably benign	0.00
R4972:Col24a1	UTSW	3	145509684	missense	probably benign	0.42
R5157:Col24a1	UTSW	3	145345951	nonsense	probably null
R5216:Col24a1	UTSW	3	145315310	missense	possibly damaging	0.85
R5274:Col24a1	UTSW	3	145484678	missense	probably benign	0.03
R5334:Col24a1	UTSW	3	145461525	missense	possibly damaging	0.91
R5416:Col24a1	UTSW	3	145315025	nonsense	probably null
R5473:Col24a1	UTSW	3	145537261	missense	probably benign	0.41
R5538:Col24a1	UTSW	3	145293121	missense	probably damaging	0.99
R5561:Col24a1	UTSW	3	145298827	missense	probably benign	0.26
R5648:Col24a1	UTSW	3	145358566	missense	probably benign	0.00
R5920:Col24a1	UTSW	3	145428230	missense	probably damaging	1.00
R6111:Col24a1	UTSW	3	145314054	missense	probably damaging	0.99
R6151:Col24a1	UTSW	3	145314054	missense	probably damaging	0.99
R6701:Col24a1	UTSW	3	145314380	missense	probably benign	0.00
R6728:Col24a1	UTSW	3	145315196	missense	probably benign
R6734:Col24a1	UTSW	3	145508674	missense	probably benign	0.06
R6861:Col24a1	UTSW	3	145460834	missense	probably damaging	1.00
R6982:Col24a1	UTSW	3	145315046	nonsense	probably null
R7001:Col24a1	UTSW	3	145298866	missense	probably benign	0.28
R7148:Col24a1	UTSW	3	145315299	missense	probably damaging	1.00
R7293:Col24a1	UTSW	3	145486304	nonsense	probably null
R7315:Col24a1	UTSW	3	145431870	missense	possibly damaging	0.82
R7358:Col24a1	UTSW	3	145293165	critical splice donor site	probably null
R7371:Col24a1	UTSW	3	145343698	missense	probably benign	0.06
R7383:Col24a1	UTSW	3	145298838	missense	probably benign
R7605:Col24a1	UTSW	3	145538687	missense	possibly damaging	0.67
R7650:Col24a1	UTSW	3	145314453	missense	probably benign	0.00
R7679:Col24a1	UTSW	3	145399355	missense	possibly damaging	0.81
R7701:Col24a1	UTSW	3	145315011	missense	probably benign
R7701:Col24a1	UTSW	3	145366901	splice site	probably null
R7805:Col24a1	UTSW	3	145314140	missense	probably benign	0.02
R7913:Col24a1	UTSW	3	145431866	nonsense	probably null
R7921:Col24a1	UTSW	3	145474238	missense	probably damaging	1.00
R8056:Col24a1	UTSW	3	145314164	missense	possibly damaging	0.73
R8240:Col24a1	UTSW	3	145507702	missense	probably benign	0.31
R8294:Col24a1	UTSW	3	145481089	missense	probably null	1.00
R8305:Col24a1	UTSW	3	145474182	missense	probably benign	0.00
R8430:Col24a1	UTSW	3	145315299	missense	probably damaging	1.00
R8708:Col24a1	UTSW	3	145545265	missense	probably damaging	0.99
R8880:Col24a1	UTSW	3	145314037	missense	probably null
R9056:Col24a1	UTSW	3	145315248	missense	probably damaging	0.96
R9461:Col24a1	UTSW	3	145481124	nonsense	probably null
R9612:Col24a1	UTSW	3	145545205	missense	probably benign	0.32
R9777:Col24a1	UTSW	3	145315342	nonsense	probably null
Z1176:Col24a1	UTSW	3	145342498	missense	probably damaging	1.00
Z1177:Col24a1	UTSW	3	145342499	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCAGCCTGGTAGGAAGAAGTCCTTTAG -3'
(R):5'- GTACAACAAGACTCTGGGACAGCAC -3'

Sequencing Primer
(F):5'- GGAAGAAGTCCTTTAGGTACATTGC -3'
(R):5'- CAGTGCTAAAATGTTCCAGTAGTCAG -3'

Posted On

2014-05-09