Incidental Mutation 'R1664:Col24a1'
ID 186995
Institutional Source Beutler Lab
Gene Symbol Col24a1
Ensembl Gene ENSMUSG00000028197
Gene Name collagen, type XXIV, alpha 1
Synonyms 5430404K19Rik
MMRRC Submission 039700-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1664 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 144998233-145257766 bp(+) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 145095355 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000029848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029848]
AlphaFold Q30D77
Predicted Effect probably null
Transcript: ENSMUST00000029848
SMART Domains Protein: ENSMUSP00000029848
Gene: ENSMUSG00000028197

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
TSPN 41 230 2.7e-3 SMART
LamG 106 229 8.07e-2 SMART
Pfam:Collagen 506 565 9.6e-10 PFAM
Pfam:Collagen 561 623 3.4e-10 PFAM
Pfam:Collagen 604 678 2.3e-9 PFAM
low complexity region 682 724 N/A INTRINSIC
Pfam:Collagen 772 837 1.3e-10 PFAM
Pfam:Collagen 865 938 6e-9 PFAM
Pfam:Collagen 967 1042 3.1e-8 PFAM
low complexity region 1056 1075 N/A INTRINSIC
Pfam:Collagen 1107 1180 8e-9 PFAM
Pfam:Collagen 1159 1218 4.2e-10 PFAM
Pfam:Collagen 1218 1279 1.8e-10 PFAM
Pfam:Collagen 1270 1334 3.1e-9 PFAM
Pfam:Collagen 1378 1443 1.3e-9 PFAM
Pfam:Collagen 1439 1500 1.8e-9 PFAM
COLFI 1533 1733 9.34e-34 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of type XXIV collagen, one of the low abundance fibril-forming collagens found in cartilage. The encoded protein has structural features of invertebrate fibrillar collagens and is expressed predominantly in bone tissue. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik T A 14: 35,533,772 (GRCm39) T45S probably benign Het
Ackr1 A G 1: 173,160,433 (GRCm39) F29L probably benign Het
Adgrf2 T A 17: 43,025,305 (GRCm39) S60C possibly damaging Het
Alpk2 A G 18: 65,482,944 (GRCm39) C355R probably damaging Het
Ankmy1 A C 1: 92,812,913 (GRCm39) D465E probably benign Het
Ankrd27 T A 7: 35,306,551 (GRCm39) D310E probably damaging Het
Ap3d1 G A 10: 80,553,571 (GRCm39) Q559* probably null Het
C4b T C 17: 34,951,952 (GRCm39) T1298A probably damaging Het
Casr T A 16: 36,330,327 (GRCm39) K336* probably null Het
Ccdc116 A T 16: 16,960,492 (GRCm39) D108E probably benign Het
Ccdc168 T A 1: 44,098,387 (GRCm39) I904F possibly damaging Het
Ccr7 A T 11: 99,036,517 (GRCm39) I135N possibly damaging Het
Cd96 A G 16: 45,938,364 (GRCm39) Y34H possibly damaging Het
Cdan1 T A 2: 120,550,987 (GRCm39) D1135V probably damaging Het
Cecr2 C A 6: 120,738,987 (GRCm39) T1210K probably damaging Het
Cep152 C A 2: 125,408,174 (GRCm39) A1390S probably benign Het
Chd9 T G 8: 91,749,418 (GRCm39) probably null Het
Cntnap5c G T 17: 58,600,985 (GRCm39) W776L probably benign Het
Cpa2 G T 6: 30,554,314 (GRCm39) M311I probably damaging Het
Cpz A G 5: 35,664,087 (GRCm39) F483L probably damaging Het
Ddx19a A C 8: 111,716,130 (GRCm39) V90G probably damaging Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fbxw7 A G 3: 84,876,478 (GRCm39) D213G possibly damaging Het
Fgd2 T C 17: 29,588,273 (GRCm39) F362L probably damaging Het
Fryl A G 5: 73,216,778 (GRCm39) Y2171H probably damaging Het
Gba2 T C 4: 43,578,080 (GRCm39) R90G probably benign Het
Gm10073 T C 8: 107,299,864 (GRCm39) E40G probably damaging Het
Grhl3 T C 4: 135,279,861 (GRCm39) I398V probably benign Het
Grip2 T A 6: 91,742,233 (GRCm39) H899L probably damaging Het
Grk2 T C 19: 4,337,268 (GRCm39) K644E possibly damaging Het
Iars1 A T 13: 49,865,251 (GRCm39) T576S probably damaging Het
Kif26b G A 1: 178,759,704 (GRCm39) V2084M probably damaging Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Lrrc69 G A 4: 14,775,079 (GRCm39) T63M probably damaging Het
Lrrn4 A T 2: 132,711,886 (GRCm39) C646S probably damaging Het
Mtf2 C T 5: 108,252,342 (GRCm39) T457M probably damaging Het
Ncln A T 10: 81,323,555 (GRCm39) C531S probably benign Het
Ntn4 C T 10: 93,543,215 (GRCm39) R314W probably damaging Het
Or14j8 T C 17: 38,263,784 (GRCm39) I44V probably benign Het
Or5v1 C T 17: 37,810,316 (GRCm39) T258M possibly damaging Het
Or8c11 A T 9: 38,289,548 (GRCm39) M124L possibly damaging Het
Otogl A G 10: 107,642,437 (GRCm39) V1331A probably benign Het
Palb2 A G 7: 121,723,615 (GRCm39) probably benign Het
Pcdh20 T C 14: 88,705,758 (GRCm39) E514G possibly damaging Het
Pclaf A G 9: 65,797,730 (GRCm39) N7S probably benign Het
Pdrg1 C T 2: 152,857,248 (GRCm39) probably benign Het
Phf8-ps T A 17: 33,285,492 (GRCm39) I437F probably damaging Het
Pik3r6 T A 11: 68,426,932 (GRCm39) D464E probably benign Het
Pkp3 A G 7: 140,667,560 (GRCm39) N454D probably damaging Het
Plekha7 C A 7: 115,734,269 (GRCm39) probably null Het
Ppip5k1 A G 2: 121,167,663 (GRCm39) V784A probably benign Het
Ppp1r36 T A 12: 76,483,028 (GRCm39) D205E possibly damaging Het
Prss35 A T 9: 86,637,700 (GRCm39) T157S probably benign Het
Ptprn2 T C 12: 117,125,329 (GRCm39) L621P probably damaging Het
Rasgrp3 A G 17: 75,831,172 (GRCm39) K524R probably damaging Het
Rasgrp4 T A 7: 28,839,688 (GRCm39) H133Q probably benign Het
Reln A T 5: 22,134,084 (GRCm39) Y2615N probably damaging Het
Rpf1 T A 3: 146,217,903 (GRCm39) T204S probably benign Het
Scgb2b3 T A 7: 31,058,464 (GRCm39) *113L probably null Het
Scn5a A C 9: 119,350,243 (GRCm39) L877R possibly damaging Het
Sh3pxd2a A T 19: 47,256,821 (GRCm39) D632E probably benign Het
Slc39a10 T C 1: 46,865,269 (GRCm39) H522R probably damaging Het
Spink2 A T 5: 77,354,855 (GRCm39) C19S probably damaging Het
Spsb4 A G 9: 96,878,266 (GRCm39) L19P possibly damaging Het
St7l T C 3: 104,778,214 (GRCm39) V117A probably damaging Het
Stac2 C T 11: 97,933,420 (GRCm39) S174N probably damaging Het
Sult4a1 A G 15: 83,970,818 (GRCm39) Y196H probably benign Het
Tex2 C T 11: 106,458,608 (GRCm39) probably benign Het
Tprg1l A T 4: 154,243,862 (GRCm39) V98D possibly damaging Het
Ttn G A 2: 76,548,369 (GRCm39) H31978Y probably damaging Het
Ttn T C 2: 76,658,853 (GRCm39) probably benign Het
Tyk2 C A 9: 21,031,649 (GRCm39) R447L probably damaging Het
Ucn3 T C 13: 3,991,634 (GRCm39) Y6C possibly damaging Het
Urb1 A T 16: 90,584,970 (GRCm39) probably null Het
Vmn2r94 G C 17: 18,464,406 (GRCm39) A628G probably damaging Het
Wdr95 C A 5: 149,518,752 (GRCm39) T389K probably damaging Het
Wrn A T 8: 33,770,794 (GRCm39) probably null Het
Xab2 T A 8: 3,669,068 (GRCm39) probably null Het
Zfp458 A T 13: 67,406,144 (GRCm39) N95K possibly damaging Het
Zfp672 T C 11: 58,208,138 (GRCm39) H61R probably damaging Het
Zfp942 C T 17: 22,147,420 (GRCm39) G403E possibly damaging Het
Other mutations in Col24a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Col24a1 APN 3 145,068,064 (GRCm39) missense probably damaging 1.00
IGL00931:Col24a1 APN 3 145,167,225 (GRCm39) missense probably benign 0.00
IGL01160:Col24a1 APN 3 145,213,468 (GRCm39) missense probably damaging 1.00
IGL01355:Col24a1 APN 3 145,020,637 (GRCm39) missense probably benign 0.07
IGL01409:Col24a1 APN 3 145,244,319 (GRCm39) missense probably benign 0.19
IGL01587:Col24a1 APN 3 145,139,110 (GRCm39) splice site probably null
IGL01666:Col24a1 APN 3 145,050,447 (GRCm39) missense possibly damaging 0.93
IGL01717:Col24a1 APN 3 145,230,018 (GRCm39) splice site probably benign
IGL01721:Col24a1 APN 3 145,244,322 (GRCm39) missense probably benign 0.26
IGL01939:Col24a1 APN 3 145,021,005 (GRCm39) missense probably damaging 1.00
IGL01988:Col24a1 APN 3 145,229,922 (GRCm39) splice site probably null
IGL02002:Col24a1 APN 3 145,062,699 (GRCm39) missense possibly damaging 0.81
IGL02172:Col24a1 APN 3 145,020,723 (GRCm39) missense probably benign 0.34
IGL02552:Col24a1 APN 3 145,179,962 (GRCm39) missense possibly damaging 0.88
IGL02559:Col24a1 APN 3 145,019,934 (GRCm39) missense probably benign
IGL02582:Col24a1 APN 3 145,020,247 (GRCm39) missense probably damaging 1.00
IGL02652:Col24a1 APN 3 145,198,056 (GRCm39) nonsense probably null
IGL02942:Col24a1 APN 3 145,247,420 (GRCm39) missense probably damaging 1.00
IGL03032:Col24a1 APN 3 145,244,458 (GRCm39) critical splice donor site probably null
IGL03108:Col24a1 APN 3 145,029,162 (GRCm39) missense probably damaging 1.00
IGL03310:Col24a1 APN 3 145,019,744 (GRCm39) splice site probably benign
IGL03405:Col24a1 APN 3 145,020,918 (GRCm39) missense possibly damaging 0.73
R0066:Col24a1 UTSW 3 145,250,899 (GRCm39) missense probably damaging 1.00
R0066:Col24a1 UTSW 3 145,250,899 (GRCm39) missense probably damaging 1.00
R0379:Col24a1 UTSW 3 145,229,897 (GRCm39) missense possibly damaging 0.94
R0502:Col24a1 UTSW 3 145,251,071 (GRCm39) splice site probably benign
R0556:Col24a1 UTSW 3 145,020,489 (GRCm39) missense possibly damaging 0.53
R0587:Col24a1 UTSW 3 144,998,906 (GRCm39) missense possibly damaging 0.50
R0617:Col24a1 UTSW 3 145,019,881 (GRCm39) missense probably damaging 1.00
R0831:Col24a1 UTSW 3 145,034,520 (GRCm39) missense probably damaging 1.00
R1455:Col24a1 UTSW 3 145,166,593 (GRCm39) missense probably damaging 1.00
R1713:Col24a1 UTSW 3 145,072,624 (GRCm39) nonsense probably null
R1854:Col24a1 UTSW 3 145,164,895 (GRCm39) missense probably damaging 1.00
R1855:Col24a1 UTSW 3 145,164,895 (GRCm39) missense probably damaging 1.00
R1861:Col24a1 UTSW 3 145,243,022 (GRCm39) critical splice donor site probably null
R1969:Col24a1 UTSW 3 145,020,691 (GRCm39) missense probably benign 0.03
R2216:Col24a1 UTSW 3 145,020,742 (GRCm39) missense probably benign 0.34
R2290:Col24a1 UTSW 3 145,218,950 (GRCm39) missense probably damaging 1.00
R3702:Col24a1 UTSW 3 145,043,621 (GRCm39) missense probably benign 0.01
R3772:Col24a1 UTSW 3 145,251,041 (GRCm39) missense probably damaging 1.00
R4086:Col24a1 UTSW 3 145,167,192 (GRCm39) missense probably damaging 1.00
R4236:Col24a1 UTSW 3 145,230,037 (GRCm39) nonsense probably null
R4433:Col24a1 UTSW 3 145,020,144 (GRCm39) missense possibly damaging 0.95
R4688:Col24a1 UTSW 3 145,020,144 (GRCm39) missense probably benign 0.00
R4972:Col24a1 UTSW 3 145,215,439 (GRCm39) missense probably benign 0.42
R5157:Col24a1 UTSW 3 145,051,712 (GRCm39) nonsense probably null
R5216:Col24a1 UTSW 3 145,021,071 (GRCm39) missense possibly damaging 0.85
R5274:Col24a1 UTSW 3 145,190,433 (GRCm39) missense probably benign 0.03
R5334:Col24a1 UTSW 3 145,167,280 (GRCm39) missense possibly damaging 0.91
R5416:Col24a1 UTSW 3 145,020,786 (GRCm39) nonsense probably null
R5473:Col24a1 UTSW 3 145,243,016 (GRCm39) missense probably benign 0.41
R5538:Col24a1 UTSW 3 144,998,882 (GRCm39) missense probably damaging 0.99
R5561:Col24a1 UTSW 3 145,004,588 (GRCm39) missense probably benign 0.26
R5648:Col24a1 UTSW 3 145,064,321 (GRCm39) missense probably benign 0.00
R5920:Col24a1 UTSW 3 145,133,985 (GRCm39) missense probably damaging 1.00
R6111:Col24a1 UTSW 3 145,019,815 (GRCm39) missense probably damaging 0.99
R6151:Col24a1 UTSW 3 145,019,815 (GRCm39) missense probably damaging 0.99
R6701:Col24a1 UTSW 3 145,020,141 (GRCm39) missense probably benign 0.00
R6728:Col24a1 UTSW 3 145,020,957 (GRCm39) missense probably benign
R6734:Col24a1 UTSW 3 145,214,429 (GRCm39) missense probably benign 0.06
R6861:Col24a1 UTSW 3 145,166,589 (GRCm39) missense probably damaging 1.00
R6982:Col24a1 UTSW 3 145,020,807 (GRCm39) nonsense probably null
R7001:Col24a1 UTSW 3 145,004,627 (GRCm39) missense probably benign 0.28
R7148:Col24a1 UTSW 3 145,021,060 (GRCm39) missense probably damaging 1.00
R7293:Col24a1 UTSW 3 145,192,059 (GRCm39) nonsense probably null
R7315:Col24a1 UTSW 3 145,137,625 (GRCm39) missense possibly damaging 0.82
R7358:Col24a1 UTSW 3 144,998,926 (GRCm39) critical splice donor site probably null
R7371:Col24a1 UTSW 3 145,049,459 (GRCm39) missense probably benign 0.06
R7383:Col24a1 UTSW 3 145,004,599 (GRCm39) missense probably benign
R7605:Col24a1 UTSW 3 145,244,442 (GRCm39) missense possibly damaging 0.67
R7650:Col24a1 UTSW 3 145,020,214 (GRCm39) missense probably benign 0.00
R7679:Col24a1 UTSW 3 145,105,110 (GRCm39) missense possibly damaging 0.81
R7701:Col24a1 UTSW 3 145,072,656 (GRCm39) splice site probably null
R7701:Col24a1 UTSW 3 145,020,772 (GRCm39) missense probably benign
R7805:Col24a1 UTSW 3 145,019,901 (GRCm39) missense probably benign 0.02
R7913:Col24a1 UTSW 3 145,137,621 (GRCm39) nonsense probably null
R7921:Col24a1 UTSW 3 145,179,993 (GRCm39) missense probably damaging 1.00
R8056:Col24a1 UTSW 3 145,019,925 (GRCm39) missense possibly damaging 0.73
R8240:Col24a1 UTSW 3 145,213,457 (GRCm39) missense probably benign 0.31
R8294:Col24a1 UTSW 3 145,186,844 (GRCm39) missense probably null 1.00
R8305:Col24a1 UTSW 3 145,179,937 (GRCm39) missense probably benign 0.00
R8430:Col24a1 UTSW 3 145,021,060 (GRCm39) missense probably damaging 1.00
R8708:Col24a1 UTSW 3 145,251,020 (GRCm39) missense probably damaging 0.99
R8880:Col24a1 UTSW 3 145,019,798 (GRCm39) missense probably null
R9056:Col24a1 UTSW 3 145,021,009 (GRCm39) missense probably damaging 0.96
R9461:Col24a1 UTSW 3 145,186,879 (GRCm39) nonsense probably null
R9612:Col24a1 UTSW 3 145,250,960 (GRCm39) missense probably benign 0.32
R9777:Col24a1 UTSW 3 145,021,103 (GRCm39) nonsense probably null
Z1176:Col24a1 UTSW 3 145,048,259 (GRCm39) missense probably damaging 1.00
Z1177:Col24a1 UTSW 3 145,048,260 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGCCTGGTAGGAAGAAGTCCTTTAG -3'
(R):5'- GTACAACAAGACTCTGGGACAGCAC -3'

Sequencing Primer
(F):5'- GGAAGAAGTCCTTTAGGTACATTGC -3'
(R):5'- CAGTGCTAAAATGTTCCAGTAGTCAG -3'
Posted On 2014-05-09