Mutagenetix > Incidental Mutations

Incidental Mutation 'R1664:Gba2'

186998

Institutional Source

Beutler Lab

Gene Symbol

Gba2

Ensembl Gene

ENSMUSG00000028467

Gene Name

glucosidase beta 2

Synonyms

bile acid

MMRRC Submission

039700-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1664 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

43566928-43578873 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 43578080 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 90 (R90G)

Ref Sequence

ENSEMBL: ENSMUSP00000119589 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030189] [ENSMUST00000030190] [ENSMUST00000107886] [ENSMUST00000117140] [ENSMUST00000130443]

Predicted Effect

probably benign
Transcript: ENSMUST00000030189
AA Change: R90G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000030189
Gene: ENSMUSG00000028467
AA Change: R90G

Domain	Start	End	E-Value	Type
Pfam:GBA2_N	142	446	9.4e-106	PFAM
Pfam:DUF608	512	879	1.3e-153	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000030190

SMART Domains

Protein: ENSMUSP00000030190
Gene: ENSMUSG00000028468

Domain	Start	End	E-Value	Type
low complexity region	34	47	N/A	INTRINSIC
Pfam:Rgp1	66	212	3.4e-34	PFAM
Pfam:Rgp1	182	332	1.2e-41	PFAM
low complexity region	333	347	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000107886

SMART Domains

Protein: ENSMUSP00000103518
Gene: ENSMUSG00000028468

Domain	Start	End	E-Value	Type
low complexity region	34	47	N/A	INTRINSIC
low complexity region	63	77	N/A	INTRINSIC
Pfam:Rgp1	84	164	3.3e-24	PFAM
Pfam:Rgp1	174	331	4.1e-26	PFAM
low complexity region	333	347	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000117140

SMART Domains

Protein: ENSMUSP00000113476
Gene: ENSMUSG00000028468

Domain	Start	End	E-Value	Type
low complexity region	34	47	N/A	INTRINSIC
low complexity region	63	77	N/A	INTRINSIC
Pfam:Rgp1	84	165	2.9e-24	PFAM
Pfam:Rgp1	173	331	3.5e-26	PFAM
low complexity region	333	347	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128403

Predicted Effect

probably benign
Transcript: ENSMUST00000130443
AA Change: R90G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000119589
Gene: ENSMUSG00000028467
AA Change: R90G

Domain	Start	End	E-Value	Type
Pfam:GBA2_N	142	180	5.6e-13	PFAM
Pfam:GBA2_N	178	227	1.5e-13	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131178

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135895

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141612

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141782

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144968

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152251

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148426

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microsomal beta-glucosidase that catalyzes the hydrolysis of bile acid 3-O-glucosides as endogenous compounds. Studies to determine subcellular localization of this protein in the liver indicated that the enzyme was mainly enriched in the microsomal fraction where it appeared to be confined to the endoplasmic reticulum. This putative transmembrane protein is thought to play a role in carbohydrate transport and metabolism. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit accumulation of glucosylceramides in multiple tissues, and show impaired male fertility associated with globozoospermia, oligozoospermia, reduced sperm motility, and male germ cell apoptosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	T	A	17: 33,066,518	I437F	probably damaging	Het
4930596D02Rik	T	A	14: 35,811,815	T45S	probably benign	Het
Ackr1	A	G	1: 173,332,866	F29L	probably benign	Het
Adgrf2	T	A	17: 42,714,414	S60C	possibly damaging	Het
Alpk2	A	G	18: 65,349,873	C355R	probably damaging	Het
Ankmy1	A	C	1: 92,885,191	D465E	probably benign	Het
Ankrd27	T	A	7: 35,607,126	D310E	probably damaging	Het
Ap3d1	G	A	10: 80,717,737	Q559*	probably null	Het
C4b	T	C	17: 34,732,978	T1298A	probably damaging	Het
Casr	T	A	16: 36,509,965	K336*	probably null	Het
Ccdc116	A	T	16: 17,142,628	D108E	probably benign	Het
Ccr7	A	T	11: 99,145,691	I135N	possibly damaging	Het
Cd96	A	G	16: 46,118,001	Y34H	possibly damaging	Het
Cdan1	T	A	2: 120,720,506	D1135V	probably damaging	Het
Cecr2	C	A	6: 120,762,026	T1210K	probably damaging	Het
Cep152	C	A	2: 125,566,254	A1390S	probably benign	Het
Chd9	T	G	8: 91,022,790		probably null	Het
Cntnap5c	G	T	17: 58,293,990	W776L	probably benign	Het
Col24a1	G	A	3: 145,389,600		probably null	Het
Cpa2	G	T	6: 30,554,315	M311I	probably damaging	Het
Cpz	A	G	5: 35,506,743	F483L	probably damaging	Het
Ddx19a	A	C	8: 110,989,498	V90G	probably damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fbxw7	A	G	3: 84,969,171	D213G	possibly damaging	Het
Fgd2	T	C	17: 29,369,299	F362L	probably damaging	Het
Fryl	A	G	5: 73,059,435	Y2171H	probably damaging	Het
Gm10073	T	C	8: 106,573,232	E40G	probably damaging	Het
Gm8251	T	A	1: 44,059,227	I904F	possibly damaging	Het
Grhl3	T	C	4: 135,552,550	I398V	probably benign	Het
Grip2	T	A	6: 91,765,252	H899L	probably damaging	Het
Grk2	T	C	19: 4,287,240	K644E	possibly damaging	Het
Iars	A	T	13: 49,711,775	T576S	probably damaging	Het
Kif26b	G	A	1: 178,932,139	V2084M	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lrrc69	G	A	4: 14,775,079	T63M	probably damaging	Het
Lrrn4	A	T	2: 132,869,966	C646S	probably damaging	Het
Mtf2	C	T	5: 108,104,476	T457M	probably damaging	Het
Ncln	A	T	10: 81,487,721	C531S	probably benign	Het
Ntn4	C	T	10: 93,707,353	R314W	probably damaging	Het
Olfr110	C	T	17: 37,499,425	T258M	possibly damaging	Het
Olfr251	A	T	9: 38,378,252	M124L	possibly damaging	Het
Olfr761	T	C	17: 37,952,893	I44V	probably benign	Het
Otogl	A	G	10: 107,806,576	V1331A	probably benign	Het
Palb2	A	G	7: 122,124,392		probably benign	Het
Pcdh20	T	C	14: 88,468,322	E514G	possibly damaging	Het
Pclaf	A	G	9: 65,890,448	N7S	probably benign	Het
Pdrg1	C	T	2: 153,015,328		probably benign	Het
Pik3r6	T	A	11: 68,536,106	D464E	probably benign	Het
Pkp3	A	G	7: 141,087,647	N454D	probably damaging	Het
Plekha7	C	A	7: 116,135,034		probably null	Het
Ppip5k1	A	G	2: 121,337,182	V784A	probably benign	Het
Ppp1r36	T	A	12: 76,436,254	D205E	possibly damaging	Het
Prss35	A	T	9: 86,755,647	T157S	probably benign	Het
Ptprn2	T	C	12: 117,161,709	L621P	probably damaging	Het
Rasgrp3	A	G	17: 75,524,177	K524R	probably damaging	Het
Rasgrp4	T	A	7: 29,140,263	H133Q	probably benign	Het
Reln	A	T	5: 21,929,086	Y2615N	probably damaging	Het
Rpf1	T	A	3: 146,512,148	T204S	probably benign	Het
Scgb2b3	T	A	7: 31,359,039	*113L	probably null	Het
Scn5a	A	C	9: 119,521,177	L877R	possibly damaging	Het
Sh3pxd2a	A	T	19: 47,268,382	D632E	probably benign	Het
Slc39a10	T	C	1: 46,826,109	H522R	probably damaging	Het
Spink2	A	T	5: 77,207,008	C19S	probably damaging	Het
Spsb4	A	G	9: 96,996,213	L19P	possibly damaging	Het
St7l	T	C	3: 104,870,898	V117A	probably damaging	Het
Stac2	C	T	11: 98,042,594	S174N	probably damaging	Het
Sult4a1	A	G	15: 84,086,617	Y196H	probably benign	Het
Tex2	C	T	11: 106,567,782		probably benign	Het
Tprgl	A	T	4: 154,159,405	V98D	possibly damaging	Het
Ttn	G	A	2: 76,718,025	H31978Y	probably damaging	Het
Ttn	T	C	2: 76,828,509		probably benign	Het
Tyk2	C	A	9: 21,120,353	R447L	probably damaging	Het
Ucn3	T	C	13: 3,941,634	Y6C	possibly damaging	Het
Urb1	A	T	16: 90,788,082		probably null	Het
Vmn2r94	G	C	17: 18,244,144	A628G	probably damaging	Het
Wdr95	C	A	5: 149,595,287	T389K	probably damaging	Het
Wrn	A	T	8: 33,280,766		probably null	Het
Xab2	T	A	8: 3,619,068		probably null	Het
Zfp458	A	T	13: 67,258,080	N95K	possibly damaging	Het
Zfp672	T	C	11: 58,317,312	H61R	probably damaging	Het
Zfp942	C	T	17: 21,928,439	G403E	possibly damaging	Het

Other mutations in Gba2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00501:Gba2	APN	4	43568477	missense	probably damaging	1.00
IGL01577:Gba2	APN	4	43573753	nonsense	probably null
IGL02066:Gba2	APN	4	43570175	missense	probably benign	0.18
IGL02126:Gba2	APN	4	43567918	critical splice acceptor site	probably null
IGL02243:Gba2	APN	4	43568719	missense	probably benign	0.13
IGL02474:Gba2	APN	4	43568538	missense	possibly damaging	0.69
IGL02567:Gba2	APN	4	43567281	missense	probably benign
IGL02628:Gba2	APN	4	43568919	missense	probably benign	0.01
IGL02706:Gba2	APN	4	43567257	missense	probably benign	0.01
IGL02795:Gba2	APN	4	43578331	missense	probably damaging	1.00
R0389:Gba2	UTSW	4	43570832	missense	probably damaging	1.00
R0555:Gba2	UTSW	4	43569927	missense	probably damaging	1.00
R0650:Gba2	UTSW	4	43570424	splice site	probably null
R1603:Gba2	UTSW	4	43567823	missense	probably damaging	1.00
R1628:Gba2	UTSW	4	43570118	missense	probably benign	0.00
R1686:Gba2	UTSW	4	43573869	splice site	probably benign
R1730:Gba2	UTSW	4	43578242	missense	probably benign	0.01
R2036:Gba2	UTSW	4	43568118	unclassified	probably benign
R2061:Gba2	UTSW	4	43574029	nonsense	probably null
R2259:Gba2	UTSW	4	43570107	missense	probably benign
R2847:Gba2	UTSW	4	43568000	splice site	probably null
R3026:Gba2	UTSW	4	43578308	missense	possibly damaging	0.95
R3617:Gba2	UTSW	4	43573803	missense	probably damaging	1.00
R4225:Gba2	UTSW	4	43569464	unclassified	probably benign
R4346:Gba2	UTSW	4	43571337	missense	probably benign	0.04
R4601:Gba2	UTSW	4	43573810	missense	probably damaging	1.00
R4611:Gba2	UTSW	4	43568092	missense	probably damaging	1.00
R4664:Gba2	UTSW	4	43568619	unclassified	probably benign
R4784:Gba2	UTSW	4	43568315	missense	probably damaging	1.00
R4785:Gba2	UTSW	4	43568315	missense	probably damaging	1.00
R5079:Gba2	UTSW	4	43568640	unclassified	probably benign
R5327:Gba2	UTSW	4	43574063	missense	probably damaging	1.00
R5746:Gba2	UTSW	4	43568465	splice site	probably null
R6052:Gba2	UTSW	4	43568330	missense	probably damaging	1.00
R6485:Gba2	UTSW	4	43574118	missense	probably damaging	1.00
R7073:Gba2	UTSW	4	43573753	missense	probably damaging	1.00
R7112:Gba2	UTSW	4	43568453	missense	probably benign	0.01
R7472:Gba2	UTSW	4	43568967	missense	probably benign	0.44
R8220:Gba2	UTSW	4	43568510	missense	probably damaging	1.00
R8315:Gba2	UTSW	4	43569937	frame shift	probably null
R8476:Gba2	UTSW	4	43569944	missense	probably damaging	0.98
R8477:Gba2	UTSW	4	43569944	missense	probably damaging	0.98
RF007:Gba2	UTSW	4	43569894	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCTCCGAGAAGACAAGATGCTAGG -3'
(R):5'- ATAGTGGACCCCAGGATGAACCAAG -3'

Sequencing Primer
(F):5'- ACAAAATGTTCTTCAGTTCCACC -3'
(R):5'- GCTACTGCAATTCAGAGGACTC -3'

Posted On

2014-05-09