Incidental Mutation 'R1664:Grhl3'
ID 187001
Institutional Source Beutler Lab
Gene Symbol Grhl3
Ensembl Gene ENSMUSG00000037188
Gene Name grainyhead like transcription factor 3
Synonyms ct, Som, Get1
MMRRC Submission 039700-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.945) question?
Stock # R1664 (G1)
Quality Score 192
Status Not validated
Chromosome 4
Chromosomal Location 135269199-135300941 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 135279861 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 398 (I398V)
Ref Sequence ENSEMBL: ENSMUSP00000101481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105855]
AlphaFold Q5FWH3
Predicted Effect probably benign
Transcript: ENSMUST00000105855
AA Change: I398V

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101481
Gene: ENSMUSG00000037188
AA Change: I398V

DomainStartEndE-ValueType
Pfam:CP2 215 421 2.5e-81 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the grainyhead family of transcription factors. The encoded protein may function as a transcription factor during development, and has been shown to stimulate migration of endothelial cells. Multiple transcript variants encoding distinct isoforms have been identified for this gene.[provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for the variably penetrant curly-tail mutation (ct) show symptoms of cranial or spinal neural tube defects such as curly tails and/or spina bifida; homozygotes with more severe phenotypes display exencephaly and die in utero. Homozygous knockout mice show severe neural tube defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik T A 14: 35,533,772 (GRCm39) T45S probably benign Het
Ackr1 A G 1: 173,160,433 (GRCm39) F29L probably benign Het
Adgrf2 T A 17: 43,025,305 (GRCm39) S60C possibly damaging Het
Alpk2 A G 18: 65,482,944 (GRCm39) C355R probably damaging Het
Ankmy1 A C 1: 92,812,913 (GRCm39) D465E probably benign Het
Ankrd27 T A 7: 35,306,551 (GRCm39) D310E probably damaging Het
Ap3d1 G A 10: 80,553,571 (GRCm39) Q559* probably null Het
C4b T C 17: 34,951,952 (GRCm39) T1298A probably damaging Het
Casr T A 16: 36,330,327 (GRCm39) K336* probably null Het
Ccdc116 A T 16: 16,960,492 (GRCm39) D108E probably benign Het
Ccdc168 T A 1: 44,098,387 (GRCm39) I904F possibly damaging Het
Ccr7 A T 11: 99,036,517 (GRCm39) I135N possibly damaging Het
Cd96 A G 16: 45,938,364 (GRCm39) Y34H possibly damaging Het
Cdan1 T A 2: 120,550,987 (GRCm39) D1135V probably damaging Het
Cecr2 C A 6: 120,738,987 (GRCm39) T1210K probably damaging Het
Cep152 C A 2: 125,408,174 (GRCm39) A1390S probably benign Het
Chd9 T G 8: 91,749,418 (GRCm39) probably null Het
Cntnap5c G T 17: 58,600,985 (GRCm39) W776L probably benign Het
Col24a1 G A 3: 145,095,355 (GRCm39) probably null Het
Cpa2 G T 6: 30,554,314 (GRCm39) M311I probably damaging Het
Cpz A G 5: 35,664,087 (GRCm39) F483L probably damaging Het
Ddx19a A C 8: 111,716,130 (GRCm39) V90G probably damaging Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fbxw7 A G 3: 84,876,478 (GRCm39) D213G possibly damaging Het
Fgd2 T C 17: 29,588,273 (GRCm39) F362L probably damaging Het
Fryl A G 5: 73,216,778 (GRCm39) Y2171H probably damaging Het
Gba2 T C 4: 43,578,080 (GRCm39) R90G probably benign Het
Gm10073 T C 8: 107,299,864 (GRCm39) E40G probably damaging Het
Grip2 T A 6: 91,742,233 (GRCm39) H899L probably damaging Het
Grk2 T C 19: 4,337,268 (GRCm39) K644E possibly damaging Het
Iars1 A T 13: 49,865,251 (GRCm39) T576S probably damaging Het
Kif26b G A 1: 178,759,704 (GRCm39) V2084M probably damaging Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Lrrc69 G A 4: 14,775,079 (GRCm39) T63M probably damaging Het
Lrrn4 A T 2: 132,711,886 (GRCm39) C646S probably damaging Het
Mtf2 C T 5: 108,252,342 (GRCm39) T457M probably damaging Het
Ncln A T 10: 81,323,555 (GRCm39) C531S probably benign Het
Ntn4 C T 10: 93,543,215 (GRCm39) R314W probably damaging Het
Or14j8 T C 17: 38,263,784 (GRCm39) I44V probably benign Het
Or5v1 C T 17: 37,810,316 (GRCm39) T258M possibly damaging Het
Or8c11 A T 9: 38,289,548 (GRCm39) M124L possibly damaging Het
Otogl A G 10: 107,642,437 (GRCm39) V1331A probably benign Het
Palb2 A G 7: 121,723,615 (GRCm39) probably benign Het
Pcdh20 T C 14: 88,705,758 (GRCm39) E514G possibly damaging Het
Pclaf A G 9: 65,797,730 (GRCm39) N7S probably benign Het
Pdrg1 C T 2: 152,857,248 (GRCm39) probably benign Het
Phf8-ps T A 17: 33,285,492 (GRCm39) I437F probably damaging Het
Pik3r6 T A 11: 68,426,932 (GRCm39) D464E probably benign Het
Pkp3 A G 7: 140,667,560 (GRCm39) N454D probably damaging Het
Plekha7 C A 7: 115,734,269 (GRCm39) probably null Het
Ppip5k1 A G 2: 121,167,663 (GRCm39) V784A probably benign Het
Ppp1r36 T A 12: 76,483,028 (GRCm39) D205E possibly damaging Het
Prss35 A T 9: 86,637,700 (GRCm39) T157S probably benign Het
Ptprn2 T C 12: 117,125,329 (GRCm39) L621P probably damaging Het
Rasgrp3 A G 17: 75,831,172 (GRCm39) K524R probably damaging Het
Rasgrp4 T A 7: 28,839,688 (GRCm39) H133Q probably benign Het
Reln A T 5: 22,134,084 (GRCm39) Y2615N probably damaging Het
Rpf1 T A 3: 146,217,903 (GRCm39) T204S probably benign Het
Scgb2b3 T A 7: 31,058,464 (GRCm39) *113L probably null Het
Scn5a A C 9: 119,350,243 (GRCm39) L877R possibly damaging Het
Sh3pxd2a A T 19: 47,256,821 (GRCm39) D632E probably benign Het
Slc39a10 T C 1: 46,865,269 (GRCm39) H522R probably damaging Het
Spink2 A T 5: 77,354,855 (GRCm39) C19S probably damaging Het
Spsb4 A G 9: 96,878,266 (GRCm39) L19P possibly damaging Het
St7l T C 3: 104,778,214 (GRCm39) V117A probably damaging Het
Stac2 C T 11: 97,933,420 (GRCm39) S174N probably damaging Het
Sult4a1 A G 15: 83,970,818 (GRCm39) Y196H probably benign Het
Tex2 C T 11: 106,458,608 (GRCm39) probably benign Het
Tprg1l A T 4: 154,243,862 (GRCm39) V98D possibly damaging Het
Ttn G A 2: 76,548,369 (GRCm39) H31978Y probably damaging Het
Ttn T C 2: 76,658,853 (GRCm39) probably benign Het
Tyk2 C A 9: 21,031,649 (GRCm39) R447L probably damaging Het
Ucn3 T C 13: 3,991,634 (GRCm39) Y6C possibly damaging Het
Urb1 A T 16: 90,584,970 (GRCm39) probably null Het
Vmn2r94 G C 17: 18,464,406 (GRCm39) A628G probably damaging Het
Wdr95 C A 5: 149,518,752 (GRCm39) T389K probably damaging Het
Wrn A T 8: 33,770,794 (GRCm39) probably null Het
Xab2 T A 8: 3,669,068 (GRCm39) probably null Het
Zfp458 A T 13: 67,406,144 (GRCm39) N95K possibly damaging Het
Zfp672 T C 11: 58,208,138 (GRCm39) H61R probably damaging Het
Zfp942 C T 17: 22,147,420 (GRCm39) G403E possibly damaging Het
Other mutations in Grhl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02638:Grhl3 APN 4 135,284,176 (GRCm39) missense probably benign 0.00
IGL02868:Grhl3 APN 4 135,281,915 (GRCm39) missense probably damaging 1.00
Bite-size UTSW 4 135,284,744 (GRCm39) missense possibly damaging 0.46
hammerkop UTSW 4 135,273,557 (GRCm39) missense probably damaging 1.00
hoopoe UTSW 4 135,286,457 (GRCm39) missense probably benign 0.00
Tropicbird UTSW 4 135,286,415 (GRCm39) nonsense probably null
R0121:Grhl3 UTSW 4 135,279,860 (GRCm39) missense probably damaging 0.97
R0180:Grhl3 UTSW 4 135,281,841 (GRCm39) missense probably benign 0.00
R0627:Grhl3 UTSW 4 135,279,992 (GRCm39) missense probably benign 0.18
R0727:Grhl3 UTSW 4 135,273,565 (GRCm39) missense possibly damaging 0.90
R1248:Grhl3 UTSW 4 135,288,617 (GRCm39) missense probably benign 0.01
R2910:Grhl3 UTSW 4 135,286,457 (GRCm39) missense probably benign 0.00
R2911:Grhl3 UTSW 4 135,286,457 (GRCm39) missense probably benign 0.00
R3773:Grhl3 UTSW 4 135,283,158 (GRCm39) nonsense probably null
R4033:Grhl3 UTSW 4 135,300,735 (GRCm39) start codon destroyed probably benign
R4521:Grhl3 UTSW 4 135,273,561 (GRCm39) missense probably damaging 1.00
R4576:Grhl3 UTSW 4 135,288,562 (GRCm39) missense probably damaging 1.00
R4650:Grhl3 UTSW 4 135,276,547 (GRCm39) splice site probably null
R4697:Grhl3 UTSW 4 135,275,777 (GRCm39) missense probably damaging 1.00
R4919:Grhl3 UTSW 4 135,286,415 (GRCm39) nonsense probably null
R4920:Grhl3 UTSW 4 135,286,415 (GRCm39) nonsense probably null
R4961:Grhl3 UTSW 4 135,279,918 (GRCm39) missense probably damaging 1.00
R5100:Grhl3 UTSW 4 135,269,986 (GRCm39) missense probably benign
R5180:Grhl3 UTSW 4 135,286,415 (GRCm39) nonsense probably null
R5181:Grhl3 UTSW 4 135,286,415 (GRCm39) nonsense probably null
R5325:Grhl3 UTSW 4 135,286,415 (GRCm39) nonsense probably null
R6429:Grhl3 UTSW 4 135,284,507 (GRCm39) missense probably damaging 0.99
R6459:Grhl3 UTSW 4 135,284,744 (GRCm39) missense possibly damaging 0.46
R7047:Grhl3 UTSW 4 135,276,551 (GRCm39) splice site probably null
R7073:Grhl3 UTSW 4 135,300,723 (GRCm39) missense probably benign 0.00
R7345:Grhl3 UTSW 4 135,273,557 (GRCm39) missense probably damaging 1.00
R7797:Grhl3 UTSW 4 135,286,416 (GRCm39) missense possibly damaging 0.93
R7829:Grhl3 UTSW 4 135,288,532 (GRCm39) missense probably damaging 0.98
R8023:Grhl3 UTSW 4 135,277,640 (GRCm39) missense probably benign
R8472:Grhl3 UTSW 4 135,284,176 (GRCm39) missense probably benign 0.00
R8499:Grhl3 UTSW 4 135,276,549 (GRCm39) critical splice donor site probably null
R8766:Grhl3 UTSW 4 135,300,724 (GRCm39) missense probably benign 0.00
R8836:Grhl3 UTSW 4 135,288,640 (GRCm39) missense probably damaging 1.00
R9466:Grhl3 UTSW 4 135,283,412 (GRCm39) missense probably benign 0.06
Z1177:Grhl3 UTSW 4 135,279,997 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCCATAGAGCCCGATTTACAGACC -3'
(R):5'- TCCTTAGCGTGAAGTGTCACCTCC -3'

Sequencing Primer
(F):5'- CGAGCACACAGAGGAATTGA -3'
(R):5'- CTGAACTCTGAGATCTGAGTAGACC -3'
Posted On 2014-05-09