Incidental Mutation 'R1664:Otogl'
ID187038
Institutional Source Beutler Lab
Gene Symbol Otogl
Ensembl Gene ENSMUSG00000091455
Gene Nameotogelin-like
SynonymsGm6924
MMRRC Submission 039700-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1664 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location107760531-107912134 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107806576 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1331 (V1331A)
Ref Sequence ENSEMBL: ENSMUSP00000129467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165341]
Predicted Effect probably benign
Transcript: ENSMUST00000165341
AA Change: V1331A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000129467
Gene: ENSMUSG00000091455
AA Change: V1331A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
EGF_like 71 101 3.36e1 SMART
VWD 104 264 4.74e-29 SMART
C8 305 378 6.13e-6 SMART
VWD 463 625 7e-41 SMART
C8 668 733 3.6e-3 SMART
Pfam:TIL 736 791 2.3e-11 PFAM
SCOP:d1coua_ 833 911 1e-6 SMART
VWD 928 1085 1.29e-30 SMART
C8 1120 1194 1.81e-26 SMART
Pfam:AbfB 1230 1350 1.2e-10 PFAM
Pfam:TIL 1364 1418 6.1e-8 PFAM
VWD 1497 1671 2.34e-10 SMART
C8 1705 1775 9.56e-17 SMART
Pfam:TIL 1778 1836 1.6e-8 PFAM
low complexity region 1870 1886 N/A INTRINSIC
CT 2242 2325 6.9e-14 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the otogelin family. This gene is expressed in the inner ear of vertebrates with the highest level of expression seen at the embryonic stage and lowest in adult. Knockdown studies in zebrafish suggest that this gene is essential for normal inner ear function. Mutations in this gene are associated with autosomal recessive deafness. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T A 17: 33,066,518 I437F probably damaging Het
4930596D02Rik T A 14: 35,811,815 T45S probably benign Het
Ackr1 A G 1: 173,332,866 F29L probably benign Het
Adgrf2 T A 17: 42,714,414 S60C possibly damaging Het
Alpk2 A G 18: 65,349,873 C355R probably damaging Het
Ankmy1 A C 1: 92,885,191 D465E probably benign Het
Ankrd27 T A 7: 35,607,126 D310E probably damaging Het
Ap3d1 G A 10: 80,717,737 Q559* probably null Het
C4b T C 17: 34,732,978 T1298A probably damaging Het
Casr T A 16: 36,509,965 K336* probably null Het
Ccdc116 A T 16: 17,142,628 D108E probably benign Het
Ccr7 A T 11: 99,145,691 I135N possibly damaging Het
Cd96 A G 16: 46,118,001 Y34H possibly damaging Het
Cdan1 T A 2: 120,720,506 D1135V probably damaging Het
Cecr2 C A 6: 120,762,026 T1210K probably damaging Het
Cep152 C A 2: 125,566,254 A1390S probably benign Het
Chd9 T G 8: 91,022,790 probably null Het
Cntnap5c G T 17: 58,293,990 W776L probably benign Het
Col24a1 G A 3: 145,389,600 probably null Het
Cpa2 G T 6: 30,554,315 M311I probably damaging Het
Cpz A G 5: 35,506,743 F483L probably damaging Het
Ddx19a A C 8: 110,989,498 V90G probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbxw7 A G 3: 84,969,171 D213G possibly damaging Het
Fgd2 T C 17: 29,369,299 F362L probably damaging Het
Fryl A G 5: 73,059,435 Y2171H probably damaging Het
Gba2 T C 4: 43,578,080 R90G probably benign Het
Gm10073 T C 8: 106,573,232 E40G probably damaging Het
Gm8251 T A 1: 44,059,227 I904F possibly damaging Het
Grhl3 T C 4: 135,552,550 I398V probably benign Het
Grip2 T A 6: 91,765,252 H899L probably damaging Het
Grk2 T C 19: 4,287,240 K644E possibly damaging Het
Iars A T 13: 49,711,775 T576S probably damaging Het
Kif26b G A 1: 178,932,139 V2084M probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrrc69 G A 4: 14,775,079 T63M probably damaging Het
Lrrn4 A T 2: 132,869,966 C646S probably damaging Het
Mtf2 C T 5: 108,104,476 T457M probably damaging Het
Ncln A T 10: 81,487,721 C531S probably benign Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr110 C T 17: 37,499,425 T258M possibly damaging Het
Olfr251 A T 9: 38,378,252 M124L possibly damaging Het
Olfr761 T C 17: 37,952,893 I44V probably benign Het
Palb2 A G 7: 122,124,392 probably benign Het
Pcdh20 T C 14: 88,468,322 E514G possibly damaging Het
Pclaf A G 9: 65,890,448 N7S probably benign Het
Pdrg1 C T 2: 153,015,328 probably benign Het
Pik3r6 T A 11: 68,536,106 D464E probably benign Het
Pkp3 A G 7: 141,087,647 N454D probably damaging Het
Plekha7 C A 7: 116,135,034 probably null Het
Ppip5k1 A G 2: 121,337,182 V784A probably benign Het
Ppp1r36 T A 12: 76,436,254 D205E possibly damaging Het
Prss35 A T 9: 86,755,647 T157S probably benign Het
Ptprn2 T C 12: 117,161,709 L621P probably damaging Het
Rasgrp3 A G 17: 75,524,177 K524R probably damaging Het
Rasgrp4 T A 7: 29,140,263 H133Q probably benign Het
Reln A T 5: 21,929,086 Y2615N probably damaging Het
Rpf1 T A 3: 146,512,148 T204S probably benign Het
Scgb2b3 T A 7: 31,359,039 *113L probably null Het
Scn5a A C 9: 119,521,177 L877R possibly damaging Het
Sh3pxd2a A T 19: 47,268,382 D632E probably benign Het
Slc39a10 T C 1: 46,826,109 H522R probably damaging Het
Spink2 A T 5: 77,207,008 C19S probably damaging Het
Spsb4 A G 9: 96,996,213 L19P possibly damaging Het
St7l T C 3: 104,870,898 V117A probably damaging Het
Stac2 C T 11: 98,042,594 S174N probably damaging Het
Sult4a1 A G 15: 84,086,617 Y196H probably benign Het
Tex2 C T 11: 106,567,782 probably benign Het
Tprgl A T 4: 154,159,405 V98D possibly damaging Het
Ttn G A 2: 76,718,025 H31978Y probably damaging Het
Ttn T C 2: 76,828,509 probably benign Het
Tyk2 C A 9: 21,120,353 R447L probably damaging Het
Ucn3 T C 13: 3,941,634 Y6C possibly damaging Het
Urb1 A T 16: 90,788,082 probably null Het
Vmn2r94 G C 17: 18,244,144 A628G probably damaging Het
Wdr95 C A 5: 149,595,287 T389K probably damaging Het
Wrn A T 8: 33,280,766 probably null Het
Xab2 T A 8: 3,619,068 probably null Het
Zfp458 A T 13: 67,258,080 N95K possibly damaging Het
Zfp672 T C 11: 58,317,312 H61R probably damaging Het
Zfp942 C T 17: 21,928,439 G403E possibly damaging Het
Other mutations in Otogl
AlleleSourceChrCoordTypePredicted EffectPPH Score
H8562:Otogl UTSW 10 107910956 missense probably benign 0.00
R0084:Otogl UTSW 10 107901341 missense probably damaging 0.96
R0164:Otogl UTSW 10 107874530 missense probably damaging 0.97
R0164:Otogl UTSW 10 107874530 missense probably damaging 0.97
R0238:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0238:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0239:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0239:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0294:Otogl UTSW 10 107777228 missense probably damaging 1.00
R0360:Otogl UTSW 10 107770650 splice site probably benign
R0442:Otogl UTSW 10 107876855 missense probably damaging 1.00
R0488:Otogl UTSW 10 107803605 missense probably benign 0.02
R0507:Otogl UTSW 10 107866740 missense possibly damaging 0.51
R0573:Otogl UTSW 10 107780988 missense probably benign 0.00
R0581:Otogl UTSW 10 107789040 missense possibly damaging 0.79
R0613:Otogl UTSW 10 107817070 missense probably damaging 0.99
R0614:Otogl UTSW 10 107798355 missense probably benign 0.14
R0742:Otogl UTSW 10 107866740 missense possibly damaging 0.51
R0846:Otogl UTSW 10 107772296 missense probably benign 0.40
R1146:Otogl UTSW 10 107886513 missense probably damaging 1.00
R1146:Otogl UTSW 10 107886513 missense probably damaging 1.00
R1439:Otogl UTSW 10 107779252 missense probably benign 0.02
R1457:Otogl UTSW 10 107878152 splice site probably null
R1526:Otogl UTSW 10 107869526 missense probably damaging 1.00
R1662:Otogl UTSW 10 107798357 missense possibly damaging 0.84
R1667:Otogl UTSW 10 107813965 nonsense probably null
R1695:Otogl UTSW 10 107814017 missense probably damaging 0.99
R1731:Otogl UTSW 10 107817111 missense probably damaging 1.00
R1733:Otogl UTSW 10 107783712 missense possibly damaging 0.46
R1764:Otogl UTSW 10 107899461 nonsense probably null
R1824:Otogl UTSW 10 107779831 missense probably benign
R1850:Otogl UTSW 10 107878064 missense probably damaging 1.00
R1856:Otogl UTSW 10 107854264 missense possibly damaging 0.92
R1875:Otogl UTSW 10 107899590 missense probably damaging 1.00
R1938:Otogl UTSW 10 107777575 missense probably damaging 0.98
R1986:Otogl UTSW 10 107794190 critical splice acceptor site probably null
R2072:Otogl UTSW 10 107781043 missense probably damaging 1.00
R2117:Otogl UTSW 10 107858918 missense probably benign 0.06
R2219:Otogl UTSW 10 107856977 missense probably damaging 1.00
R2508:Otogl UTSW 10 107874500 missense probably damaging 0.99
R2883:Otogl UTSW 10 107768981 missense probably damaging 1.00
R2931:Otogl UTSW 10 107820004 missense possibly damaging 0.85
R3620:Otogl UTSW 10 107874371 missense probably damaging 0.99
R3621:Otogl UTSW 10 107874371 missense probably damaging 0.99
R3735:Otogl UTSW 10 107899529 nonsense probably null
R3812:Otogl UTSW 10 107899471 missense probably damaging 1.00
R3880:Otogl UTSW 10 107827704 missense probably damaging 0.96
R3958:Otogl UTSW 10 107821925 missense probably damaging 1.00
R4063:Otogl UTSW 10 107790649 missense probably benign 0.02
R4064:Otogl UTSW 10 107790649 missense probably benign 0.02
R4108:Otogl UTSW 10 107771244 missense probably benign 0.01
R4352:Otogl UTSW 10 107869535 missense probably damaging 1.00
R4526:Otogl UTSW 10 107886980 missense probably damaging 1.00
R4614:Otogl UTSW 10 107892124 nonsense probably null
R4703:Otogl UTSW 10 107821924 missense probably damaging 1.00
R4741:Otogl UTSW 10 107779260 missense probably benign 0.00
R4790:Otogl UTSW 10 107822033 critical splice acceptor site probably null
R4801:Otogl UTSW 10 107901336 missense probably damaging 1.00
R4802:Otogl UTSW 10 107901336 missense probably damaging 1.00
R4910:Otogl UTSW 10 107879517 missense probably benign 0.05
R4913:Otogl UTSW 10 107876855 missense probably damaging 0.98
R5238:Otogl UTSW 10 107768973 missense probably damaging 1.00
R5261:Otogl UTSW 10 107777592 missense probably benign 0.16
R5387:Otogl UTSW 10 107780933 missense probably benign 0.03
R5395:Otogl UTSW 10 107817138 missense probably benign 0.39
R5403:Otogl UTSW 10 107808756 missense probably benign 0.08
R5482:Otogl UTSW 10 107821941 missense probably damaging 0.99
R5547:Otogl UTSW 10 107782048 missense possibly damaging 0.55
R5611:Otogl UTSW 10 107786769 missense probably damaging 1.00
R5642:Otogl UTSW 10 107886552 missense probably benign 0.44
R5690:Otogl UTSW 10 107777117 synonymous silent
R5711:Otogl UTSW 10 107777117 synonymous silent
R5731:Otogl UTSW 10 107881464 missense probably damaging 0.98
R5743:Otogl UTSW 10 107857001 missense possibly damaging 0.67
R5782:Otogl UTSW 10 107777117 synonymous silent
R5820:Otogl UTSW 10 107777117 synonymous silent
R5897:Otogl UTSW 10 107777117 synonymous silent
R6004:Otogl UTSW 10 107879529 missense probably damaging 1.00
R6145:Otogl UTSW 10 107777117 synonymous silent
R6146:Otogl UTSW 10 107777117 synonymous silent
R6147:Otogl UTSW 10 107777117 synonymous silent
R6149:Otogl UTSW 10 107881453 missense probably benign 0.36
R6226:Otogl UTSW 10 107771206 nonsense probably null
R6283:Otogl UTSW 10 107790500 missense probably damaging 0.98
R6414:Otogl UTSW 10 107782050 missense probably damaging 1.00
R6604:Otogl UTSW 10 107822034 splice site probably null
R6634:Otogl UTSW 10 107862304 missense probably damaging 1.00
R6727:Otogl UTSW 10 107777117 synonymous silent
R6755:Otogl UTSW 10 107853303 nonsense probably null
R6795:Otogl UTSW 10 107777117 synonymous silent
R6797:Otogl UTSW 10 107777117 synonymous silent
R6864:Otogl UTSW 10 107827806 missense probably damaging 0.96
R6924:Otogl UTSW 10 107808641 missense probably damaging 1.00
R6967:Otogl UTSW 10 107814050 missense probably benign 0.01
R7000:Otogl UTSW 10 107779831 missense probably benign
R7075:Otogl UTSW 10 107778929 missense probably benign 0.16
R7122:Otogl UTSW 10 107866654 missense probably benign 0.08
R7176:Otogl UTSW 10 107778911 missense probably damaging 1.00
R7184:Otogl UTSW 10 107763200 missense probably damaging 1.00
R7199:Otogl UTSW 10 107874533 missense possibly damaging 0.88
R7252:Otogl UTSW 10 107821943 missense probably benign 0.06
R7286:Otogl UTSW 10 107770610 missense probably benign 0.00
R7373:Otogl UTSW 10 107901251 missense probably damaging 1.00
R7449:Otogl UTSW 10 107803663 missense probably damaging 1.00
R7486:Otogl UTSW 10 107821988 missense probably damaging 1.00
R7493:Otogl UTSW 10 107886982 missense probably benign 0.06
R7659:Otogl UTSW 10 107777120 missense probably benign 0.19
R7732:Otogl UTSW 10 107806664 missense probably benign 0.01
R7754:Otogl UTSW 10 107869546 missense probably damaging 0.99
R7757:Otogl UTSW 10 107876921 missense probably damaging 1.00
R7800:Otogl UTSW 10 107886515 missense probably damaging 0.99
R7864:Otogl UTSW 10 107869567 missense probably damaging 1.00
R7879:Otogl UTSW 10 107777109 missense probably benign 0.00
R7941:Otogl UTSW 10 107806802 splice site probably null
R7956:Otogl UTSW 10 107878026 missense possibly damaging 0.62
R7988:Otogl UTSW 10 107895776 missense probably damaging 1.00
R8057:Otogl UTSW 10 107808615 missense probably benign 0.00
R8058:Otogl UTSW 10 107762426 missense probably damaging 1.00
R8127:Otogl UTSW 10 107895752 missense probably damaging 1.00
R8143:Otogl UTSW 10 107806666 missense probably damaging 1.00
R8310:Otogl UTSW 10 107777600 missense possibly damaging 0.94
R8319:Otogl UTSW 10 107853266 critical splice donor site probably null
R8339:Otogl UTSW 10 107789535 missense probably damaging 0.99
R8339:Otogl UTSW 10 107789536 missense probably benign 0.34
R8394:Otogl UTSW 10 107886465 critical splice donor site probably null
R8428:Otogl UTSW 10 107798736 missense probably damaging 1.00
R8444:Otogl UTSW 10 107857114 missense probably benign 0.01
R8501:Otogl UTSW 10 107790560 missense probably benign
R8503:Otogl UTSW 10 107892126 missense probably damaging 1.00
X0065:Otogl UTSW 10 107895782 missense probably damaging 1.00
X0067:Otogl UTSW 10 107866677 missense probably damaging 1.00
Z1176:Otogl UTSW 10 107777213 missense probably benign
Z1176:Otogl UTSW 10 107778873 missense probably damaging 0.97
Z1176:Otogl UTSW 10 107789032 missense probably benign 0.00
Z1177:Otogl UTSW 10 107763258 nonsense probably null
Z1177:Otogl UTSW 10 107853397 missense possibly damaging 0.78
Z1177:Otogl UTSW 10 107876903 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TAGCATCTCACATGGCCTGCAC -3'
(R):5'- TCTGAGGCCCTGAGTCATTAAGACC -3'

Sequencing Primer
(F):5'- CCTGCACAGAGAGTCGGATAC -3'
(R):5'- CCTTGGAATCTGCTGAAAGGC -3'
Posted On2014-05-09