Mutagenetix > Incidental Mutation

Incidental Mutation 'R1664:Ptprn2'

187047

Institutional Source

Beutler Lab

Gene Symbol

Ptprn2

Ensembl Gene

ENSMUSG00000056553

Gene Name

protein tyrosine phosphatase, receptor type, N polypeptide 2

Synonyms

phogrin, 4930425H11Rik, IA-2 beta, PTP-NP, IA-2beta

MMRRC Submission

039700-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.168) question?

Stock #

R1664 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

116485720-117276849 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 117161709 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 621 (L621P)

Ref Sequence

ENSEMBL: ENSMUSP00000139978 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070733] [ENSMUST00000190247]

AlphaFold

P80560

Predicted Effect

possibly damaging
Transcript: ENSMUST00000070733
AA Change: L621P

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000064046
Gene: ENSMUSG00000056553
AA Change: L621P

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
RESP18	58	157	1.9e-40	SMART
low complexity region	393	426	N/A	INTRINSIC
Pfam:Receptor_IA-2	495	583	1.5e-35	PFAM
low complexity region	687	707	N/A	INTRINSIC
PTPc	730	993	4.42e-119	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000190247
AA Change: L621P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000139978
Gene: ENSMUSG00000056553
AA Change: L621P

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
RESP18	58	157	1.9e-40	SMART
low complexity region	393	426	N/A	INTRINSIC
Pfam:Receptor_IA-2	494	584	2.5e-43	PFAM
transmembrane domain	602	624	N/A	INTRINSIC
low complexity region	687	707	N/A	INTRINSIC
PTPc	730	932	8.81e-64	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to receptor-like protein tyrosine phosphatases. However, tyrosine phosphatase activity has not been experimentally validated for this protein. Studies of the rat ortholog suggest that the encoded protein may instead function as a phosphatidylinositol phosphatase with the ability to dephosphorylate phosphatidylinositol 3-phosphate and phosphatidylinositol 4,5-diphosphate, and this function may be involved in the regulation of insulin secretion. This protein has been identified as an autoantigen in insulin-dependent diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Homozygous null mice display impaired glucose tolerance but normal fasting and non-fasting blood glucose and insulin levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	T	A	17: 33,066,518	I437F	probably damaging	Het
4930596D02Rik	T	A	14: 35,811,815	T45S	probably benign	Het
Ackr1	A	G	1: 173,332,866	F29L	probably benign	Het
Adgrf2	T	A	17: 42,714,414	S60C	possibly damaging	Het
Alpk2	A	G	18: 65,349,873	C355R	probably damaging	Het
Ankmy1	A	C	1: 92,885,191	D465E	probably benign	Het
Ankrd27	T	A	7: 35,607,126	D310E	probably damaging	Het
Ap3d1	G	A	10: 80,717,737	Q559*	probably null	Het
C4b	T	C	17: 34,732,978	T1298A	probably damaging	Het
Casr	T	A	16: 36,509,965	K336*	probably null	Het
Ccdc116	A	T	16: 17,142,628	D108E	probably benign	Het
Ccr7	A	T	11: 99,145,691	I135N	possibly damaging	Het
Cd96	A	G	16: 46,118,001	Y34H	possibly damaging	Het
Cdan1	T	A	2: 120,720,506	D1135V	probably damaging	Het
Cecr2	C	A	6: 120,762,026	T1210K	probably damaging	Het
Cep152	C	A	2: 125,566,254	A1390S	probably benign	Het
Chd9	T	G	8: 91,022,790		probably null	Het
Cntnap5c	G	T	17: 58,293,990	W776L	probably benign	Het
Col24a1	G	A	3: 145,389,600		probably null	Het
Cpa2	G	T	6: 30,554,315	M311I	probably damaging	Het
Cpz	A	G	5: 35,506,743	F483L	probably damaging	Het
Ddx19a	A	C	8: 110,989,498	V90G	probably damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fbxw7	A	G	3: 84,969,171	D213G	possibly damaging	Het
Fgd2	T	C	17: 29,369,299	F362L	probably damaging	Het
Fryl	A	G	5: 73,059,435	Y2171H	probably damaging	Het
Gba2	T	C	4: 43,578,080	R90G	probably benign	Het
Gm10073	T	C	8: 106,573,232	E40G	probably damaging	Het
Gm8251	T	A	1: 44,059,227	I904F	possibly damaging	Het
Grhl3	T	C	4: 135,552,550	I398V	probably benign	Het
Grip2	T	A	6: 91,765,252	H899L	probably damaging	Het
Grk2	T	C	19: 4,287,240	K644E	possibly damaging	Het
Iars	A	T	13: 49,711,775	T576S	probably damaging	Het
Kif26b	G	A	1: 178,932,139	V2084M	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lrrc69	G	A	4: 14,775,079	T63M	probably damaging	Het
Lrrn4	A	T	2: 132,869,966	C646S	probably damaging	Het
Mtf2	C	T	5: 108,104,476	T457M	probably damaging	Het
Ncln	A	T	10: 81,487,721	C531S	probably benign	Het
Ntn4	C	T	10: 93,707,353	R314W	probably damaging	Het
Olfr110	C	T	17: 37,499,425	T258M	possibly damaging	Het
Olfr251	A	T	9: 38,378,252	M124L	possibly damaging	Het
Olfr761	T	C	17: 37,952,893	I44V	probably benign	Het
Otogl	A	G	10: 107,806,576	V1331A	probably benign	Het
Palb2	A	G	7: 122,124,392		probably benign	Het
Pcdh20	T	C	14: 88,468,322	E514G	possibly damaging	Het
Pclaf	A	G	9: 65,890,448	N7S	probably benign	Het
Pdrg1	C	T	2: 153,015,328		probably benign	Het
Pik3r6	T	A	11: 68,536,106	D464E	probably benign	Het
Pkp3	A	G	7: 141,087,647	N454D	probably damaging	Het
Plekha7	C	A	7: 116,135,034		probably null	Het
Ppip5k1	A	G	2: 121,337,182	V784A	probably benign	Het
Ppp1r36	T	A	12: 76,436,254	D205E	possibly damaging	Het
Prss35	A	T	9: 86,755,647	T157S	probably benign	Het
Rasgrp3	A	G	17: 75,524,177	K524R	probably damaging	Het
Rasgrp4	T	A	7: 29,140,263	H133Q	probably benign	Het
Reln	A	T	5: 21,929,086	Y2615N	probably damaging	Het
Rpf1	T	A	3: 146,512,148	T204S	probably benign	Het
Scgb2b3	T	A	7: 31,359,039	*113L	probably null	Het
Scn5a	A	C	9: 119,521,177	L877R	possibly damaging	Het
Sh3pxd2a	A	T	19: 47,268,382	D632E	probably benign	Het
Slc39a10	T	C	1: 46,826,109	H522R	probably damaging	Het
Spink2	A	T	5: 77,207,008	C19S	probably damaging	Het
Spsb4	A	G	9: 96,996,213	L19P	possibly damaging	Het
St7l	T	C	3: 104,870,898	V117A	probably damaging	Het
Stac2	C	T	11: 98,042,594	S174N	probably damaging	Het
Sult4a1	A	G	15: 84,086,617	Y196H	probably benign	Het
Tex2	C	T	11: 106,567,782		probably benign	Het
Tprgl	A	T	4: 154,159,405	V98D	possibly damaging	Het
Ttn	G	A	2: 76,718,025	H31978Y	probably damaging	Het
Ttn	T	C	2: 76,828,509		probably benign	Het
Tyk2	C	A	9: 21,120,353	R447L	probably damaging	Het
Ucn3	T	C	13: 3,941,634	Y6C	possibly damaging	Het
Urb1	A	T	16: 90,788,082		probably null	Het
Vmn2r94	G	C	17: 18,244,144	A628G	probably damaging	Het
Wdr95	C	A	5: 149,595,287	T389K	probably damaging	Het
Wrn	A	T	8: 33,280,766		probably null	Het
Xab2	T	A	8: 3,619,068		probably null	Het
Zfp458	A	T	13: 67,258,080	N95K	possibly damaging	Het
Zfp672	T	C	11: 58,317,312	H61R	probably damaging	Het
Zfp942	C	T	17: 21,928,439	G403E	possibly damaging	Het

Other mutations in Ptprn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01695:Ptprn2	APN	12	116841388	missense	probably benign	0.02
IGL01788:Ptprn2	APN	12	116900987	missense	probably damaging	0.98
IGL02172:Ptprn2	APN	12	116873697	splice site	probably benign
IGL02339:Ptprn2	APN	12	116722104	missense	probably damaging	1.00
IGL02706:Ptprn2	APN	12	116888898	missense	probably damaging	0.96
IGL03018:Ptprn2	APN	12	117211943	missense	probably damaging	1.00
IGL03267:Ptprn2	APN	12	116876344	nonsense	probably null
BB001:Ptprn2	UTSW	12	116841264	missense	probably benign	0.00
BB011:Ptprn2	UTSW	12	116841264	missense	probably benign	0.00
IGL03014:Ptprn2	UTSW	12	117248688	missense	probably damaging	1.00
R0066:Ptprn2	UTSW	12	117276602	missense	probably benign	0.07
R0066:Ptprn2	UTSW	12	117276602	missense	probably benign	0.07
R0115:Ptprn2	UTSW	12	117211846	splice site	probably benign
R0131:Ptprn2	UTSW	12	116722091	missense	probably damaging	1.00
R0131:Ptprn2	UTSW	12	116722091	missense	probably damaging	1.00
R0132:Ptprn2	UTSW	12	116722091	missense	probably damaging	1.00
R0481:Ptprn2	UTSW	12	117211846	splice site	probably benign
R0694:Ptprn2	UTSW	12	116824355	missense	possibly damaging	0.69
R0698:Ptprn2	UTSW	12	116722130	nonsense	probably null
R0746:Ptprn2	UTSW	12	116901017	missense	probably benign	0.00
R1127:Ptprn2	UTSW	12	117212008	splice site	probably null
R1443:Ptprn2	UTSW	12	117253615	missense	probably damaging	1.00
R1508:Ptprn2	UTSW	12	117184722	missense	probably damaging	1.00
R1670:Ptprn2	UTSW	12	116722172	missense	possibly damaging	0.64
R1749:Ptprn2	UTSW	12	116580428	missense	probably benign	0.00
R2075:Ptprn2	UTSW	12	117247717	missense	probably benign	0.01
R3054:Ptprn2	UTSW	12	116722133	missense	probably damaging	1.00
R3107:Ptprn2	UTSW	12	116876180	missense	probably benign	0.04
R3109:Ptprn2	UTSW	12	116876180	missense	probably benign	0.04
R3552:Ptprn2	UTSW	12	116888877	missense	probably benign	0.00
R4193:Ptprn2	UTSW	12	116901008	missense	probably benign	0.01
R4523:Ptprn2	UTSW	12	116876000	missense	probably damaging	1.00
R4706:Ptprn2	UTSW	12	116872094	missense	probably benign	0.02
R4719:Ptprn2	UTSW	12	116824396	missense	possibly damaging	0.95
R4726:Ptprn2	UTSW	12	117247773	nonsense	probably null
R4872:Ptprn2	UTSW	12	117161694	missense	probably damaging	1.00
R4891:Ptprn2	UTSW	12	117233365	splice site	probably null
R4970:Ptprn2	UTSW	12	117276595	missense	probably damaging	1.00
R5208:Ptprn2	UTSW	12	116858928	missense	probably damaging	1.00
R5287:Ptprn2	UTSW	12	117211862	missense	probably damaging	1.00
R5419:Ptprn2	UTSW	12	117184647	missense	probably damaging	0.99
R6035:Ptprn2	UTSW	12	117255595	missense	probably damaging	1.00
R6035:Ptprn2	UTSW	12	117255595	missense	probably damaging	1.00
R6180:Ptprn2	UTSW	12	116859119	missense	probably benign	0.05
R6277:Ptprn2	UTSW	12	116876180	missense	probably benign	0.04
R6465:Ptprn2	UTSW	12	117269589	missense	probably damaging	0.96
R6488:Ptprn2	UTSW	12	116872038	missense	probably benign	0.13
R6555:Ptprn2	UTSW	12	117227200	missense	probably damaging	1.00
R6908:Ptprn2	UTSW	12	116888888	missense	probably benign	0.06
R7120:Ptprn2	UTSW	12	116872056	missense	probably benign	0.01
R7229:Ptprn2	UTSW	12	117227225	splice site	probably null
R7237:Ptprn2	UTSW	12	117161727	missense	probably benign	0.03
R7304:Ptprn2	UTSW	12	117248544	missense	probably damaging	1.00
R7355:Ptprn2	UTSW	12	116858951	missense	probably benign
R7460:Ptprn2	UTSW	12	117248681	missense	probably benign	0.05
R7577:Ptprn2	UTSW	12	116485866	start codon destroyed	probably null
R7658:Ptprn2	UTSW	12	116722119	missense	probably benign	0.01
R7666:Ptprn2	UTSW	12	116841320	missense	probably benign	0.10
R7924:Ptprn2	UTSW	12	116841264	missense	probably benign	0.00
R8219:Ptprn2	UTSW	12	117184737	missense	probably benign	0.30
R8716:Ptprn2	UTSW	12	117255548	missense	possibly damaging	0.73
R9235:Ptprn2	UTSW	12	117269651	critical splice donor site	probably null
R9605:Ptprn2	UTSW	12	117161658	missense	probably benign	0.13
X0066:Ptprn2	UTSW	12	117161760	missense	probably damaging	1.00
X0066:Ptprn2	UTSW	12	117184740	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- GTTGAGGCTGCACTAAGTCTGGAG -3'
(R):5'- CAATCCATCTTGCAACTGTGGCG -3'

Sequencing Primer
(F):5'- GTGCTGCTGGAGTCAAGG -3'
(R):5'- AAGAGCCTGTACTGTGACTTC -3'

Posted On

2014-05-09