Mutagenetix > Incidental Mutation

Incidental Mutation 'R1664:C4b'

187064

Institutional Source

Beutler Lab

Gene Symbol

C4b

Ensembl Gene

ENSMUSG00000073418

Gene Name

complement component 4B (Chido blood group)

Synonyms

C4, Ss

MMRRC Submission

039700-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1664 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

34728380-34743882 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 34732978 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1298 (T1298A)

Ref Sequence

ENSEMBL: ENSMUSP00000069418 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069507]

AlphaFold

P01029

Predicted Effect

probably damaging
Transcript: ENSMUST00000069507
AA Change: T1298A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418
AA Change: T1298A

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:A2M_N	138	231	2e-19	PFAM
A2M_N_2	470	609	2.87e-26	SMART
ANATO	700	734	3.58e-12	SMART
low complexity region	761	771	N/A	INTRINSIC
A2M	779	867	1.46e-27	SMART
Pfam:Thiol-ester_cl	995	1024	7.7e-13	PFAM
Pfam:A2M_comp	1047	1313	1.3e-82	PFAM
low complexity region	1441	1447	N/A	INTRINSIC
A2M_recep	1475	1564	1.03e-36	SMART
C345C	1608	1720	5.69e-40	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000173057

SMART Domains

Protein: ENSMUSP00000134611
Gene: ENSMUSG00000073418

Domain	Start	End	E-Value	Type
Pfam:A2M	1	62	6.5e-20	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173669

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.0%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	T	A	17: 33,066,518	I437F	probably damaging	Het
4930596D02Rik	T	A	14: 35,811,815	T45S	probably benign	Het
Ackr1	A	G	1: 173,332,866	F29L	probably benign	Het
Adgrf2	T	A	17: 42,714,414	S60C	possibly damaging	Het
Alpk2	A	G	18: 65,349,873	C355R	probably damaging	Het
Ankmy1	A	C	1: 92,885,191	D465E	probably benign	Het
Ankrd27	T	A	7: 35,607,126	D310E	probably damaging	Het
Ap3d1	G	A	10: 80,717,737	Q559*	probably null	Het
Casr	T	A	16: 36,509,965	K336*	probably null	Het
Ccdc116	A	T	16: 17,142,628	D108E	probably benign	Het
Ccr7	A	T	11: 99,145,691	I135N	possibly damaging	Het
Cd96	A	G	16: 46,118,001	Y34H	possibly damaging	Het
Cdan1	T	A	2: 120,720,506	D1135V	probably damaging	Het
Cecr2	C	A	6: 120,762,026	T1210K	probably damaging	Het
Cep152	C	A	2: 125,566,254	A1390S	probably benign	Het
Chd9	T	G	8: 91,022,790		probably null	Het
Cntnap5c	G	T	17: 58,293,990	W776L	probably benign	Het
Col24a1	G	A	3: 145,389,600		probably null	Het
Cpa2	G	T	6: 30,554,315	M311I	probably damaging	Het
Cpz	A	G	5: 35,506,743	F483L	probably damaging	Het
Ddx19a	A	C	8: 110,989,498	V90G	probably damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fbxw7	A	G	3: 84,969,171	D213G	possibly damaging	Het
Fgd2	T	C	17: 29,369,299	F362L	probably damaging	Het
Fryl	A	G	5: 73,059,435	Y2171H	probably damaging	Het
Gba2	T	C	4: 43,578,080	R90G	probably benign	Het
Gm10073	T	C	8: 106,573,232	E40G	probably damaging	Het
Gm8251	T	A	1: 44,059,227	I904F	possibly damaging	Het
Grhl3	T	C	4: 135,552,550	I398V	probably benign	Het
Grip2	T	A	6: 91,765,252	H899L	probably damaging	Het
Grk2	T	C	19: 4,287,240	K644E	possibly damaging	Het
Iars	A	T	13: 49,711,775	T576S	probably damaging	Het
Kif26b	G	A	1: 178,932,139	V2084M	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lrrc69	G	A	4: 14,775,079	T63M	probably damaging	Het
Lrrn4	A	T	2: 132,869,966	C646S	probably damaging	Het
Mtf2	C	T	5: 108,104,476	T457M	probably damaging	Het
Ncln	A	T	10: 81,487,721	C531S	probably benign	Het
Ntn4	C	T	10: 93,707,353	R314W	probably damaging	Het
Olfr110	C	T	17: 37,499,425	T258M	possibly damaging	Het
Olfr251	A	T	9: 38,378,252	M124L	possibly damaging	Het
Olfr761	T	C	17: 37,952,893	I44V	probably benign	Het
Otogl	A	G	10: 107,806,576	V1331A	probably benign	Het
Palb2	A	G	7: 122,124,392		probably benign	Het
Pcdh20	T	C	14: 88,468,322	E514G	possibly damaging	Het
Pclaf	A	G	9: 65,890,448	N7S	probably benign	Het
Pdrg1	C	T	2: 153,015,328		probably benign	Het
Pik3r6	T	A	11: 68,536,106	D464E	probably benign	Het
Pkp3	A	G	7: 141,087,647	N454D	probably damaging	Het
Plekha7	C	A	7: 116,135,034		probably null	Het
Ppip5k1	A	G	2: 121,337,182	V784A	probably benign	Het
Ppp1r36	T	A	12: 76,436,254	D205E	possibly damaging	Het
Prss35	A	T	9: 86,755,647	T157S	probably benign	Het
Ptprn2	T	C	12: 117,161,709	L621P	probably damaging	Het
Rasgrp3	A	G	17: 75,524,177	K524R	probably damaging	Het
Rasgrp4	T	A	7: 29,140,263	H133Q	probably benign	Het
Reln	A	T	5: 21,929,086	Y2615N	probably damaging	Het
Rpf1	T	A	3: 146,512,148	T204S	probably benign	Het
Scgb2b3	T	A	7: 31,359,039	*113L	probably null	Het
Scn5a	A	C	9: 119,521,177	L877R	possibly damaging	Het
Sh3pxd2a	A	T	19: 47,268,382	D632E	probably benign	Het
Slc39a10	T	C	1: 46,826,109	H522R	probably damaging	Het
Spink2	A	T	5: 77,207,008	C19S	probably damaging	Het
Spsb4	A	G	9: 96,996,213	L19P	possibly damaging	Het
St7l	T	C	3: 104,870,898	V117A	probably damaging	Het
Stac2	C	T	11: 98,042,594	S174N	probably damaging	Het
Sult4a1	A	G	15: 84,086,617	Y196H	probably benign	Het
Tex2	C	T	11: 106,567,782		probably benign	Het
Tprgl	A	T	4: 154,159,405	V98D	possibly damaging	Het
Ttn	G	A	2: 76,718,025	H31978Y	probably damaging	Het
Ttn	T	C	2: 76,828,509		probably benign	Het
Tyk2	C	A	9: 21,120,353	R447L	probably damaging	Het
Ucn3	T	C	13: 3,941,634	Y6C	possibly damaging	Het
Urb1	A	T	16: 90,788,082		probably null	Het
Vmn2r94	G	C	17: 18,244,144	A628G	probably damaging	Het
Wdr95	C	A	5: 149,595,287	T389K	probably damaging	Het
Wrn	A	T	8: 33,280,766		probably null	Het
Xab2	T	A	8: 3,619,068		probably null	Het
Zfp458	A	T	13: 67,258,080	N95K	possibly damaging	Het
Zfp672	T	C	11: 58,317,312	H61R	probably damaging	Het
Zfp942	C	T	17: 21,928,439	G403E	possibly damaging	Het

Other mutations in C4b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:C4b	APN	17	34734428	missense	probably damaging	1.00
IGL00433:C4b	APN	17	34742041	missense	possibly damaging	0.75
IGL00471:C4b	APN	17	34734429	missense	probably damaging	1.00
IGL00515:C4b	APN	17	34728891	missense	probably damaging	1.00
IGL01599:C4b	APN	17	34743019	splice site	probably benign
IGL01761:C4b	APN	17	34739938	missense	possibly damaging	0.56
IGL02004:C4b	APN	17	34739010	unclassified	probably benign
IGL02215:C4b	APN	17	34734491	missense	probably damaging	1.00
IGL02517:C4b	APN	17	34734408	missense	probably benign	0.01
IGL02926:C4b	APN	17	34730712	missense	possibly damaging	0.95
IGL03031:C4b	APN	17	34731130	missense	possibly damaging	0.47
IGL03057:C4b	APN	17	34737764	unclassified	probably benign
IGL03165:C4b	APN	17	34739955	missense	probably benign	0.13
IGL03380:C4b	APN	17	34740286	missense	probably benign	0.01
Aspiration	UTSW	17	34734442	missense	probably benign	0.00
Inspiration	UTSW	17	34732166	splice site	probably null
Peroration	UTSW	17	34729399	critical splice donor site	probably null
perspiration	UTSW	17	34729831	missense	probably damaging	1.00
FR4548:C4b	UTSW	17	34740997	missense	probably benign	0.00
PIT4142001:C4b	UTSW	17	34733701	missense	probably benign	0.01
R0064:C4b	UTSW	17	34738856	missense	probably damaging	1.00
R0113:C4b	UTSW	17	34741240	missense	probably damaging	0.98
R0143:C4b	UTSW	17	34734219	unclassified	probably benign
R0254:C4b	UTSW	17	34734776	missense	probably benign	0.00
R0320:C4b	UTSW	17	34733161	missense	probably benign	0.01
R0391:C4b	UTSW	17	34735614	splice site	probably benign
R0399:C4b	UTSW	17	34728869	missense	probably damaging	1.00
R0467:C4b	UTSW	17	34736127	missense	probably benign	0.01
R0549:C4b	UTSW	17	34735415	missense	probably damaging	1.00
R0561:C4b	UTSW	17	34734417	missense	probably damaging	0.99
R0662:C4b	UTSW	17	34730888	missense	probably damaging	1.00
R0941:C4b	UTSW	17	34740055	missense	probably benign
R1161:C4b	UTSW	17	34729593	missense	probably damaging	1.00
R1169:C4b	UTSW	17	34742972	missense	probably benign	0.14
R1186:C4b	UTSW	17	34736309	missense	possibly damaging	0.47
R1310:C4b	UTSW	17	34729593	missense	probably damaging	1.00
R1398:C4b	UTSW	17	34730719	unclassified	probably benign
R1472:C4b	UTSW	17	34743769	nonsense	probably null
R1496:C4b	UTSW	17	34740021	missense	probably benign	0.30
R1544:C4b	UTSW	17	34738967	missense	probably benign	0.13
R1588:C4b	UTSW	17	34741025	missense	probably benign
R1645:C4b	UTSW	17	34740597	missense	probably damaging	1.00
R1678:C4b	UTSW	17	34743650	missense	probably benign	0.05
R1710:C4b	UTSW	17	34743664	splice site	probably benign
R1713:C4b	UTSW	17	34729271	splice site	probably benign
R1770:C4b	UTSW	17	34736927	missense	possibly damaging	0.78
R1859:C4b	UTSW	17	34735553	missense	probably benign
R1924:C4b	UTSW	17	34729657	missense	probably damaging	1.00
R2057:C4b	UTSW	17	34728620	missense	probably damaging	1.00
R2060:C4b	UTSW	17	34736101	missense	probably damaging	1.00
R2184:C4b	UTSW	17	34737702	missense	probably benign	0.27
R2306:C4b	UTSW	17	34728518	missense	probably benign	0.00
R2363:C4b	UTSW	17	34736058	splice site	probably benign
R2365:C4b	UTSW	17	34736058	splice site	probably benign
R2379:C4b	UTSW	17	34735743	missense	possibly damaging	0.81
R2860:C4b	UTSW	17	34734758	missense	probably damaging	0.99
R2861:C4b	UTSW	17	34734758	missense	probably damaging	0.99
R3551:C4b	UTSW	17	34741872	missense	possibly damaging	0.75
R3765:C4b	UTSW	17	34729840	missense	probably damaging	0.98
R4157:C4b	UTSW	17	34742855	missense	probably damaging	1.00
R4299:C4b	UTSW	17	34731144	missense	possibly damaging	0.52
R4365:C4b	UTSW	17	34734743	missense	possibly damaging	0.65
R4411:C4b	UTSW	17	34728864	missense	probably damaging	1.00
R4613:C4b	UTSW	17	34734551	missense	probably benign	0.12
R4784:C4b	UTSW	17	34733406	missense	probably benign	0.00
R4790:C4b	UTSW	17	34734143	missense	probably benign	0.01
R4831:C4b	UTSW	17	34736890	splice site	probably null
R4879:C4b	UTSW	17	34743647	missense	probably damaging	0.99
R5036:C4b	UTSW	17	34740445	critical splice acceptor site	probably null
R5361:C4b	UTSW	17	34741238	missense	probably benign	0.15
R5384:C4b	UTSW	17	34737661	missense	possibly damaging	0.89
R5518:C4b	UTSW	17	34734442	missense	probably benign	0.00
R5590:C4b	UTSW	17	34740335	missense	probably damaging	0.98
R5643:C4b	UTSW	17	34742417	missense	probably benign	0.01
R5644:C4b	UTSW	17	34742417	missense	probably benign	0.01
R5833:C4b	UTSW	17	34730673	missense	probably damaging	1.00
R5931:C4b	UTSW	17	34729193	missense	probably damaging	0.99
R6178:C4b	UTSW	17	34733406	missense	probably benign	0.00
R6209:C4b	UTSW	17	34741087	missense	possibly damaging	0.93
R6225:C4b	UTSW	17	34738874	missense	possibly damaging	0.64
R6518:C4b	UTSW	17	34734205	missense	probably damaging	0.98
R6613:C4b	UTSW	17	34733565	missense	probably damaging	0.99
R6781:C4b	UTSW	17	34742954	missense	probably damaging	0.99
R6807:C4b	UTSW	17	34730956	missense	probably benign	0.17
R6858:C4b	UTSW	17	34729831	missense	probably damaging	1.00
R6962:C4b	UTSW	17	34732166	splice site	probably null
R7068:C4b	UTSW	17	34733477	missense	probably damaging	1.00
R7081:C4b	UTSW	17	34735443	missense	probably benign	0.27
R7105:C4b	UTSW	17	34730911	missense	possibly damaging	0.52
R7211:C4b	UTSW	17	34735534	missense	possibly damaging	0.92
R7296:C4b	UTSW	17	34743659	missense	probably damaging	1.00
R7314:C4b	UTSW	17	34740356	missense	probably benign
R7330:C4b	UTSW	17	34730472	missense	probably damaging	1.00
R7397:C4b	UTSW	17	34742390	missense	possibly damaging	0.80
R7437:C4b	UTSW	17	34734733	missense	probably benign	0.10
R7490:C4b	UTSW	17	34731080	nonsense	probably null
R7597:C4b	UTSW	17	34739675	missense	probably benign
R7633:C4b	UTSW	17	34729399	critical splice donor site	probably null
R7900:C4b	UTSW	17	34739777	missense	probably benign	0.03
R7910:C4b	UTSW	17	34740352	missense	probably benign	0.00
R7923:C4b	UTSW	17	34742380	missense	probably damaging	1.00
R7960:C4b	UTSW	17	34741278	splice site	probably null
R8420:C4b	UTSW	17	34734539	missense	probably damaging	0.97
R8467:C4b	UTSW	17	34732813	missense	possibly damaging	0.51
R8558:C4b	UTSW	17	34736567	missense	probably damaging	1.00
R8725:C4b	UTSW	17	34734485	missense	probably damaging	1.00
R8727:C4b	UTSW	17	34734485	missense	probably damaging	1.00
R8853:C4b	UTSW	17	34729905	missense	possibly damaging	0.91
R8934:C4b	UTSW	17	34732984	missense	possibly damaging	0.78
R8944:C4b	UTSW	17	34742939	missense	probably benign	0.00
R8960:C4b	UTSW	17	34733918	missense	probably damaging	1.00
R8982:C4b	UTSW	17	34734364	critical splice donor site	probably null
R9104:C4b	UTSW	17	34729259	missense	probably benign	0.39
R9114:C4b	UTSW	17	34729430	missense	probably damaging	0.99
R9348:C4b	UTSW	17	34733185	missense	probably benign	0.01
R9428:C4b	UTSW	17	34730911	missense	possibly damaging	0.52
R9533:C4b	UTSW	17	34737724	nonsense	probably null
R9591:C4b	UTSW	17	34738955	missense	probably benign	0.00
R9678:C4b	UTSW	17	34741789	critical splice donor site	probably null
Z1176:C4b	UTSW	17	34731147	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- AGAAGAGCCCAGAGGTTTGACCAC -3'
(R):5'- AGGACAAAGTTGTGTTGCGCCC -3'

Sequencing Primer
(F):5'- GAGGAGGTCACCTTTAGCTC -3'
(R):5'- TGTGTTGCGCCCCACAG -3'

Posted On

2014-05-09