Incidental Mutation 'R1665:Ikzf2'
ID187076
Institutional Source Beutler Lab
Gene Symbol Ikzf2
Ensembl Gene ENSMUSG00000025997
Gene NameIKAROS family zinc finger 2
SynonymsA730095J18Rik, Zfpn1a2, Helios
MMRRC Submission 039701-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1665 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location69531214-69687245 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 69538814 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 512 (Y512F)
Ref Sequence ENSEMBL: ENSMUSP00000027146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027146] [ENSMUST00000187184] [ENSMUST00000188110] [ENSMUST00000190771] [ENSMUST00000190855] [ENSMUST00000191262]
Predicted Effect probably damaging
Transcript: ENSMUST00000027146
AA Change: Y512F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027146
Gene: ENSMUSG00000025997
AA Change: Y512F

DomainStartEndE-ValueType
low complexity region 76 89 N/A INTRINSIC
ZnF_C2H2 112 134 7.67e-2 SMART
ZnF_C2H2 140 162 1.72e-4 SMART
ZnF_C2H2 168 190 3.95e-4 SMART
ZnF_C2H2 196 219 3.58e-2 SMART
ZnF_C2H2 471 493 9.46e0 SMART
ZnF_C2H2 499 523 6.13e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187100
Predicted Effect probably benign
Transcript: ENSMUST00000187184
AA Change: Y486F

PolyPhen 2 Score 0.239 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000141075
Gene: ENSMUSG00000025997
AA Change: Y486F

DomainStartEndE-ValueType
low complexity region 76 89 N/A INTRINSIC
ZnF_C2H2 114 136 1.72e-4 SMART
ZnF_C2H2 142 164 3.95e-4 SMART
ZnF_C2H2 170 193 3.58e-2 SMART
ZnF_C2H2 445 467 9.46e0 SMART
ZnF_C2H2 473 497 6.13e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000188110
AA Change: Y440F

PolyPhen 2 Score 0.767 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000140069
Gene: ENSMUSG00000025997
AA Change: Y440F

DomainStartEndE-ValueType
low complexity region 76 89 N/A INTRINSIC
ZnF_C2H2 114 136 7.3e-7 SMART
ZnF_C2H2 142 164 1.6e-6 SMART
ZnF_C2H2 399 421 4e-2 SMART
ZnF_C2H2 427 451 2.6e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190771
AA Change: Y518F

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139543
Gene: ENSMUSG00000025997
AA Change: Y518F

DomainStartEndE-ValueType
low complexity region 82 95 N/A INTRINSIC
ZnF_C2H2 118 140 3.2e-4 SMART
ZnF_C2H2 146 168 7.3e-7 SMART
ZnF_C2H2 174 196 1.6e-6 SMART
ZnF_C2H2 202 225 1.5e-4 SMART
ZnF_C2H2 477 499 4e-2 SMART
ZnF_C2H2 505 529 2.6e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190855
AA Change: Y438F

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140043
Gene: ENSMUSG00000025997
AA Change: Y438F

DomainStartEndE-ValueType
low complexity region 76 89 N/A INTRINSIC
ZnF_C2H2 114 136 7.3e-7 SMART
ZnF_C2H2 142 164 1.6e-6 SMART
ZnF_C2H2 170 193 1.5e-4 SMART
ZnF_C2H2 397 419 4e-2 SMART
ZnF_C2H2 425 449 2.6e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000191262
AA Change: Y367F

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000139530
Gene: ENSMUSG00000025997
AA Change: Y367F

DomainStartEndE-ValueType
ZnF_C2H2 51 74 1.5e-4 SMART
ZnF_C2H2 326 348 4e-2 SMART
ZnF_C2H2 354 378 2.6e-3 SMART
Meta Mutation Damage Score 0.5176 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ikaros family of zinc-finger proteins. Three members of this protein family (Ikaros, Aiolos and Helios) are hematopoietic-specific transcription factors involved in the regulation of lymphocyte development. This protein forms homo- or hetero-dimers with other Ikaros family members, and is thought to function predominantly in early hematopoietic development. Multiple transcript variants encoding different isoforms have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit postnatal lethality for unknown reasons. Survivors have decreased body weight. Postnatal lethality has complete penetrance on the C57BL/6 strain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G A 17: 24,377,842 G423E probably damaging Het
Acox3 A T 5: 35,603,027 H429L probably damaging Het
Afg1l T A 10: 42,426,577 K142N probably damaging Het
Aldh1a7 T C 19: 20,727,461 I18V probably benign Het
Angel2 T C 1: 190,937,467 Y115H probably damaging Het
Bsg T G 10: 79,711,518 N261K probably damaging Het
C2cd2l A T 9: 44,316,775 V83E probably benign Het
Caml C A 13: 55,631,971 L286I probably benign Het
Ccdc125 A G 13: 100,693,573 I284V probably benign Het
Ces2a G A 8: 104,737,555 probably benign Het
Cfap61 T C 2: 146,035,319 probably null Het
Creg2 C T 1: 39,623,204 W253* probably null Het
Csmd3 T C 15: 47,696,789 T2293A probably damaging Het
Cttnbp2 A T 6: 18,434,983 I292K probably benign Het
Dab2ip T A 2: 35,720,278 M770K probably damaging Het
Dct T A 14: 118,034,251 D389V probably damaging Het
Dnah17 A T 11: 118,121,495 probably benign Het
Dnah6 T C 6: 73,124,778 E1921G probably benign Het
Ehmt1 A G 2: 24,877,464 S272P probably damaging Het
Ero1lb T C 13: 12,579,261 probably null Het
Fnip2 A G 3: 79,515,149 F108S probably benign Het
Foxb1 G A 9: 69,759,822 A142V probably damaging Het
Fras1 A T 5: 96,598,909 S613C probably damaging Het
Gm11639 A G 11: 104,721,114 K594R probably benign Het
Gm7276 C A 18: 77,185,570 probably benign Het
Gnb4 A C 3: 32,590,039 L152* probably null Het
H1fnt G T 15: 98,256,915 Q118K probably benign Het
Hdac7 A G 15: 97,806,525 L119P probably damaging Het
Hsd17b4 G A 18: 50,160,215 E274K probably benign Het
Htr4 T C 18: 62,412,234 I30T probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Klhl22 C A 16: 17,776,488 D160E probably benign Het
Kpna6 T A 4: 129,657,471 R80S probably benign Het
Lclat1 A G 17: 73,188,004 E142G probably damaging Het
Lrig3 T C 10: 125,997,701 Y349H probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Map1b T A 13: 99,431,929 N1428I unknown Het
Map3k19 T A 1: 127,817,656 T1354S possibly damaging Het
Med13l T A 5: 118,749,748 W1696R probably damaging Het
Mfn1 T G 3: 32,534,322 V66G probably benign Het
Mllt10 A T 2: 18,208,790 Q459L possibly damaging Het
Morc2a G A 11: 3,675,885 V162M probably benign Het
Muc15 C T 2: 110,733,898 Q260* probably null Het
Nfkb1 T C 3: 135,594,957 H616R probably damaging Het
Nr2c1 T A 10: 94,188,183 W417R probably damaging Het
Olfr1279 T C 2: 111,306,771 C189R probably damaging Het
Olfr1285 T C 2: 111,408,753 Y113H probably damaging Het
Olfr1480 A T 19: 13,529,838 H99L probably damaging Het
Olfr250 C T 9: 38,367,566 H7Y probably benign Het
Olfr541 G T 7: 140,704,794 C181F probably damaging Het
Olfr714 T C 7: 107,074,274 S149P probably damaging Het
Pde10a A G 17: 8,898,870 D26G probably damaging Het
Pi15 G T 1: 17,621,502 C176F probably damaging Het
Pou2f2 T A 7: 25,092,724 T569S possibly damaging Het
Prf1 A C 10: 61,302,887 E208A probably benign Het
Prkd1 G A 12: 50,394,926 H277Y probably damaging Het
Rc3h1 T A 1: 160,959,423 V796E probably benign Het
Rgl1 T C 1: 152,533,575 Y503C probably damaging Het
Ripk3 T A 14: 55,786,351 H1L probably benign Het
Ryr1 C T 7: 29,036,078 D4064N probably damaging Het
Sec63 T A 10: 42,798,728 probably null Het
Slco1a4 T G 6: 141,839,577 M96L possibly damaging Het
Slit3 A T 11: 35,234,906 R137S possibly damaging Het
Smad1 T C 8: 79,372,029 E52G probably damaging Het
Srd5a2 A T 17: 74,021,481 W201R probably damaging Het
Steap1 A T 5: 5,736,498 L313Q probably damaging Het
Syt2 C A 1: 134,747,620 A403D probably damaging Het
Tax1bp1 T A 6: 52,736,912 S225R probably benign Het
Thap3 C T 4: 151,985,704 V78M probably damaging Het
Thoc5 A G 11: 4,919,792 K446R probably benign Het
Timmdc1 A C 16: 38,510,717 probably null Het
Tm6sf2 G T 8: 70,078,930 probably benign Het
Tmem126b G T 7: 90,475,971 A2E probably damaging Het
Trim9 T A 12: 70,255,113 R584W probably damaging Het
Ttn C A 2: 76,830,856 probably benign Het
Vmn1r25 A T 6: 57,978,461 I281N probably damaging Het
Wdr59 A G 8: 111,479,362 F553S probably damaging Het
Zc3h4 A G 7: 16,429,580 M575V unknown Het
Zfp53 A G 17: 21,509,504 T600A probably damaging Het
Zic5 A G 14: 122,459,527 S559P unknown Het
Other mutations in Ikzf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Ikzf2 APN 1 69539322 missense possibly damaging 0.77
IGL01295:Ikzf2 APN 1 69577987 missense probably benign 0.13
IGL01313:Ikzf2 APN 1 69539430 missense probably damaging 0.98
IGL01390:Ikzf2 APN 1 69570642 missense probably damaging 1.00
IGL01862:Ikzf2 APN 1 69538898 missense probably damaging 0.99
Freefall UTSW 1 69539097 nonsense probably null
Wigwam UTSW 1 69577796 nonsense probably null
R1079:Ikzf2 UTSW 1 69539105 missense possibly damaging 0.62
R1368:Ikzf2 UTSW 1 69539315 missense possibly damaging 0.95
R1661:Ikzf2 UTSW 1 69538814 missense probably damaging 0.99
R1688:Ikzf2 UTSW 1 69542280 missense possibly damaging 0.77
R1726:Ikzf2 UTSW 1 69548688 missense probably damaging 1.00
R1829:Ikzf2 UTSW 1 69542287 missense probably benign 0.34
R1860:Ikzf2 UTSW 1 69570502 missense probably damaging 1.00
R2507:Ikzf2 UTSW 1 69539288 missense probably benign 0.11
R4457:Ikzf2 UTSW 1 69684188 unclassified probably benign
R5633:Ikzf2 UTSW 1 69539097 nonsense probably null
R5666:Ikzf2 UTSW 1 69577900 missense probably benign 0.04
R5670:Ikzf2 UTSW 1 69577900 missense probably benign 0.04
R5836:Ikzf2 UTSW 1 69539387 missense probably damaging 1.00
R5950:Ikzf2 UTSW 1 69683244 missense probably damaging 1.00
R6492:Ikzf2 UTSW 1 69539042 missense probably damaging 1.00
R6758:Ikzf2 UTSW 1 69538900 missense probably damaging 0.97
R6809:Ikzf2 UTSW 1 69570502 missense probably damaging 1.00
R6946:Ikzf2 UTSW 1 69577796 nonsense probably null
R6959:Ikzf2 UTSW 1 69538770 makesense probably null
R7044:Ikzf2 UTSW 1 69538901 missense possibly damaging 0.93
R7236:Ikzf2 UTSW 1 69539081 missense probably benign 0.00
R7256:Ikzf2 UTSW 1 69578053 intron probably null
R7488:Ikzf2 UTSW 1 69539385 missense probably benign 0.45
R7731:Ikzf2 UTSW 1 69539143 missense possibly damaging 0.94
X0027:Ikzf2 UTSW 1 69577852 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCAGAAGACAGCATGTCGCC -3'
(R):5'- ATGATGACCGCCAGTCCTACCAAG -3'

Sequencing Primer
(F):5'- AGCATGTCGCCATCCGAG -3'
(R):5'- GGCTCTCTGAAGGACATCTATAAG -3'
Posted On2014-05-09