Incidental Mutation 'R1665:Rgl1'
ID187079
Institutional Source Beutler Lab
Gene Symbol Rgl1
Ensembl Gene ENSMUSG00000026482
Gene Nameral guanine nucleotide dissociation stimulator,-like 1
SynonymsRgl
MMRRC Submission 039701-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.317) question?
Stock #R1665 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location152516760-152766351 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 152533575 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 503 (Y503C)
Ref Sequence ENSEMBL: ENSMUSP00000107490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027760] [ENSMUST00000111857] [ENSMUST00000111859]
Predicted Effect probably damaging
Transcript: ENSMUST00000027760
AA Change: Y468C

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027760
Gene: ENSMUSG00000026482
AA Change: Y468C

DomainStartEndE-ValueType
RasGEFN 64 196 5.86e-39 SMART
RasGEF 228 502 9.56e-116 SMART
Blast:RasGEF 522 582 6e-8 BLAST
low complexity region 585 596 N/A INTRINSIC
low complexity region 627 637 N/A INTRINSIC
RA 648 735 1.7e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111857
AA Change: Y466C

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107488
Gene: ENSMUSG00000026482
AA Change: Y466C

DomainStartEndE-ValueType
RasGEFN 62 194 5.86e-39 SMART
RasGEF 226 500 9.56e-116 SMART
Blast:RasGEF 520 580 7e-8 BLAST
low complexity region 583 594 N/A INTRINSIC
low complexity region 625 635 N/A INTRINSIC
RA 646 733 1.7e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111859
AA Change: Y503C

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107490
Gene: ENSMUSG00000026482
AA Change: Y503C

DomainStartEndE-ValueType
RasGEFN 99 231 5.86e-39 SMART
RasGEF 263 537 9.56e-116 SMART
Blast:RasGEF 557 617 6e-8 BLAST
low complexity region 620 631 N/A INTRINSIC
low complexity region 662 672 N/A INTRINSIC
RA 683 770 1.7e-25 SMART
Meta Mutation Damage Score 0.6193 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: This gene encodes a member of the Ras-like (Ral) -selective guanine nucleotide exchange factor (RalGEF) family of small GTPase activators which function both as downstream effectors of activated Ras GTPase and as regulators of certain Ral GTPases in the RalGEF - Ral GTPase signaling pathway. The encoded protein, like other RalGEFs, has an N-terminal ras exchanger motif domain, a catalytic CDC25 homology domain, and a C-terminal ras binding domain that stimulates guanine nucleotide exchange when bound to a Ral GTPase. RalGEF family members bridge the Ras and Ral signaling pathways and are thought to play a role in oncogenic transformation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G A 17: 24,377,842 G423E probably damaging Het
Acox3 A T 5: 35,603,027 H429L probably damaging Het
Afg1l T A 10: 42,426,577 K142N probably damaging Het
Aldh1a7 T C 19: 20,727,461 I18V probably benign Het
Angel2 T C 1: 190,937,467 Y115H probably damaging Het
Bsg T G 10: 79,711,518 N261K probably damaging Het
C2cd2l A T 9: 44,316,775 V83E probably benign Het
Caml C A 13: 55,631,971 L286I probably benign Het
Ccdc125 A G 13: 100,693,573 I284V probably benign Het
Ces2a G A 8: 104,737,555 probably benign Het
Cfap61 T C 2: 146,035,319 probably null Het
Creg2 C T 1: 39,623,204 W253* probably null Het
Csmd3 T C 15: 47,696,789 T2293A probably damaging Het
Cttnbp2 A T 6: 18,434,983 I292K probably benign Het
Dab2ip T A 2: 35,720,278 M770K probably damaging Het
Dct T A 14: 118,034,251 D389V probably damaging Het
Dnah17 A T 11: 118,121,495 probably benign Het
Dnah6 T C 6: 73,124,778 E1921G probably benign Het
Ehmt1 A G 2: 24,877,464 S272P probably damaging Het
Ero1lb T C 13: 12,579,261 probably null Het
Fnip2 A G 3: 79,515,149 F108S probably benign Het
Foxb1 G A 9: 69,759,822 A142V probably damaging Het
Fras1 A T 5: 96,598,909 S613C probably damaging Het
Gm11639 A G 11: 104,721,114 K594R probably benign Het
Gm7276 C A 18: 77,185,570 probably benign Het
Gnb4 A C 3: 32,590,039 L152* probably null Het
H1fnt G T 15: 98,256,915 Q118K probably benign Het
Hdac7 A G 15: 97,806,525 L119P probably damaging Het
Hsd17b4 G A 18: 50,160,215 E274K probably benign Het
Htr4 T C 18: 62,412,234 I30T probably damaging Het
Ikzf2 T A 1: 69,538,814 Y512F probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Klhl22 C A 16: 17,776,488 D160E probably benign Het
Kpna6 T A 4: 129,657,471 R80S probably benign Het
Lclat1 A G 17: 73,188,004 E142G probably damaging Het
Lrig3 T C 10: 125,997,701 Y349H probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Map1b T A 13: 99,431,929 N1428I unknown Het
Map3k19 T A 1: 127,817,656 T1354S possibly damaging Het
Med13l T A 5: 118,749,748 W1696R probably damaging Het
Mfn1 T G 3: 32,534,322 V66G probably benign Het
Mllt10 A T 2: 18,208,790 Q459L possibly damaging Het
Morc2a G A 11: 3,675,885 V162M probably benign Het
Muc15 C T 2: 110,733,898 Q260* probably null Het
Nfkb1 T C 3: 135,594,957 H616R probably damaging Het
Nr2c1 T A 10: 94,188,183 W417R probably damaging Het
Olfr1279 T C 2: 111,306,771 C189R probably damaging Het
Olfr1285 T C 2: 111,408,753 Y113H probably damaging Het
Olfr1480 A T 19: 13,529,838 H99L probably damaging Het
Olfr250 C T 9: 38,367,566 H7Y probably benign Het
Olfr541 G T 7: 140,704,794 C181F probably damaging Het
Olfr714 T C 7: 107,074,274 S149P probably damaging Het
Pde10a A G 17: 8,898,870 D26G probably damaging Het
Pi15 G T 1: 17,621,502 C176F probably damaging Het
Pou2f2 T A 7: 25,092,724 T569S possibly damaging Het
Prf1 A C 10: 61,302,887 E208A probably benign Het
Prkd1 G A 12: 50,394,926 H277Y probably damaging Het
Rc3h1 T A 1: 160,959,423 V796E probably benign Het
Ripk3 T A 14: 55,786,351 H1L probably benign Het
Ryr1 C T 7: 29,036,078 D4064N probably damaging Het
Sec63 T A 10: 42,798,728 probably null Het
Slco1a4 T G 6: 141,839,577 M96L possibly damaging Het
Slit3 A T 11: 35,234,906 R137S possibly damaging Het
Smad1 T C 8: 79,372,029 E52G probably damaging Het
Srd5a2 A T 17: 74,021,481 W201R probably damaging Het
Steap1 A T 5: 5,736,498 L313Q probably damaging Het
Syt2 C A 1: 134,747,620 A403D probably damaging Het
Tax1bp1 T A 6: 52,736,912 S225R probably benign Het
Thap3 C T 4: 151,985,704 V78M probably damaging Het
Thoc5 A G 11: 4,919,792 K446R probably benign Het
Timmdc1 A C 16: 38,510,717 probably null Het
Tm6sf2 G T 8: 70,078,930 probably benign Het
Tmem126b G T 7: 90,475,971 A2E probably damaging Het
Trim9 T A 12: 70,255,113 R584W probably damaging Het
Ttn C A 2: 76,830,856 probably benign Het
Vmn1r25 A T 6: 57,978,461 I281N probably damaging Het
Wdr59 A G 8: 111,479,362 F553S probably damaging Het
Zc3h4 A G 7: 16,429,580 M575V unknown Het
Zfp53 A G 17: 21,509,504 T600A probably damaging Het
Zic5 A G 14: 122,459,527 S559P unknown Het
Other mutations in Rgl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Rgl1 APN 1 152571617 missense probably benign 0.02
IGL01065:Rgl1 APN 1 152519142 missense probably damaging 1.00
IGL01390:Rgl1 APN 1 152571588 splice site probably benign
IGL01726:Rgl1 APN 1 152519153 missense probably damaging 1.00
IGL01837:Rgl1 APN 1 152549150 missense probably damaging 1.00
IGL02019:Rgl1 APN 1 152528469 splice site probably benign
IGL02369:Rgl1 APN 1 152533606 missense probably damaging 1.00
R0240:Rgl1 UTSW 1 152554424 unclassified probably benign
R0255:Rgl1 UTSW 1 152552596 missense probably damaging 1.00
R0562:Rgl1 UTSW 1 152539945 missense probably damaging 1.00
R0648:Rgl1 UTSW 1 152536265 critical splice donor site probably null
R0734:Rgl1 UTSW 1 152554300 missense probably damaging 0.98
R1187:Rgl1 UTSW 1 152544433 missense probably benign 0.14
R1522:Rgl1 UTSW 1 152586533 missense probably damaging 1.00
R1595:Rgl1 UTSW 1 152675023 splice site probably benign
R1634:Rgl1 UTSW 1 152524772 missense probably damaging 1.00
R1661:Rgl1 UTSW 1 152533575 missense probably damaging 0.99
R1964:Rgl1 UTSW 1 152549104 missense probably damaging 1.00
R2291:Rgl1 UTSW 1 152536281 missense probably damaging 1.00
R4272:Rgl1 UTSW 1 152536289 missense probably benign 0.13
R4668:Rgl1 UTSW 1 152521371 missense probably damaging 1.00
R4669:Rgl1 UTSW 1 152521371 missense probably damaging 1.00
R4747:Rgl1 UTSW 1 152524699 nonsense probably null
R4830:Rgl1 UTSW 1 152554330 missense probably benign 0.11
R4853:Rgl1 UTSW 1 152557574 missense probably benign 0.07
R4969:Rgl1 UTSW 1 152549062 splice site probably null
R5778:Rgl1 UTSW 1 152552421 missense probably benign 0.05
R5979:Rgl1 UTSW 1 152557493 missense probably damaging 1.00
R6180:Rgl1 UTSW 1 152519172 missense probably damaging 1.00
R6183:Rgl1 UTSW 1 152586570 missense possibly damaging 0.94
R6322:Rgl1 UTSW 1 152552435 missense probably damaging 0.98
R6678:Rgl1 UTSW 1 152524724 missense probably damaging 1.00
R6759:Rgl1 UTSW 1 152533530 missense probably damaging 0.99
R6892:Rgl1 UTSW 1 152539940 missense probably benign 0.00
R7290:Rgl1 UTSW 1 152544395 missense possibly damaging 0.78
R7363:Rgl1 UTSW 1 152519163 missense probably damaging 1.00
R7610:Rgl1 UTSW 1 152552620 missense probably damaging 1.00
Z1088:Rgl1 UTSW 1 152675020 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GTGAAATCTCCCTTCACAGCCCAG -3'
(R):5'- AGGCAGCCAGATTGCAGAGTCTTC -3'

Sequencing Primer
(F):5'- GAGCATGGCTACTATTCTAATAGGGC -3'
(R):5'- GCAGAGTCTTCTTCAATGGC -3'
Posted On2014-05-09