Incidental Mutation 'R1665:Nfkb1'
ID187093
Institutional Source Beutler Lab
Gene Symbol Nfkb1
Ensembl Gene ENSMUSG00000028163
Gene Namenuclear factor of kappa light polypeptide gene enhancer in B cells 1, p105
Synonymsp50 subunit of NF kappaB, nuclear factor kappaB p50, NF-kappaB, NF-kappaB p50, p50, p50/p105, NF kappaB1
MMRRC Submission 039701-MU
Accession Numbers

Ncbi RefSeq: NM_008689.2; MGI: 97312

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1665 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location135584655-135691547 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 135594957 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 616 (H616R)
Ref Sequence ENSEMBL: ENSMUSP00000128345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029812] [ENSMUST00000164430] [ENSMUST00000196469]
PDB Structure
STRUCTURE OF NF-KB P50 HOMODIMER BOUND TO A KB SITE [X-RAY DIFFRACTION]
IKAPPABALPHA/NF-KAPPAB COMPLEX [X-RAY DIFFRACTION]
Crystal structure of a NF-kB heterodimer bound to an IFNb-kB [X-RAY DIFFRACTION]
Crystal structure of a NF-kB heterodimer bound to the Ig/HIV-kB siti [X-RAY DIFFRACTION]
The kB DNA sequence from the HLV-LTR functions as an allosteric regulator of HIV transcription [X-RAY DIFFRACTION]
STRUCTURE OF THE NUCLEAR FACTOR KAPPA-B (NF-KB) P50 HOMODIMER [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF NF-kB(p50)2 COMPLEXED TO A HIGH-AFFINITY RNA APTAMER [X-RAY DIFFRACTION]
Crystal stucture of WLAC mutant of dimerisation domain of NF-kB p50 transcription factor [X-RAY DIFFRACTION]
Crystal stucture of MLAV mutant of dimerisation domain of NF-kB p50 transcription factor [X-RAY DIFFRACTION]
Crystal stucture of ILAC mutant of dimerisation domain of NF-kB p50 transcription factor [X-RAY DIFFRACTION]
>> 7 additional structures at PDB <<
Predicted Effect probably damaging
Transcript: ENSMUST00000029812
AA Change: H616R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029812
Gene: ENSMUSG00000028163
AA Change: H616R

DomainStartEndE-ValueType
Pfam:RHD 42 240 2.9e-75 PFAM
IPT 247 348 1.14e-22 SMART
low complexity region 368 414 N/A INTRINSIC
ANK 538 568 2.27e1 SMART
ANK 577 606 1.11e-2 SMART
ANK 610 640 2.47e0 SMART
ANK 646 675 5.53e-3 SMART
ANK 680 710 1.9e-1 SMART
ANK 714 743 2.18e-1 SMART
DEATH 801 888 1.9e-19 SMART
low complexity region 890 902 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129428
Predicted Effect unknown
Transcript: ENSMUST00000132668
AA Change: H255R
SMART Domains Protein: ENSMUSP00000114798
Gene: ENSMUSG00000028163
AA Change: H255R

DomainStartEndE-ValueType
low complexity region 8 54 N/A INTRINSIC
Blast:IPT 55 156 4e-22 BLAST
ANK 178 208 2.27e1 SMART
ANK 217 246 1.11e-2 SMART
ANK 250 280 2.47e0 SMART
ANK 286 315 5.53e-3 SMART
ANK 320 350 1.9e-1 SMART
ANK 354 383 2.18e-1 SMART
Blast:DEATH 441 505 1e-34 BLAST
PDB:2DBF|A 442 505 5e-32 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150007
Predicted Effect probably damaging
Transcript: ENSMUST00000164430
AA Change: H616R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128345
Gene: ENSMUSG00000028163
AA Change: H616R

DomainStartEndE-ValueType
Pfam:RHD_DNA_bind 42 240 2.9e-75 PFAM
IPT 247 348 1.14e-22 SMART
low complexity region 368 414 N/A INTRINSIC
ANK 538 568 2.27e1 SMART
ANK 577 606 1.11e-2 SMART
ANK 610 640 2.47e0 SMART
ANK 646 675 5.53e-3 SMART
ANK 680 710 1.9e-1 SMART
ANK 714 743 2.18e-1 SMART
DEATH 801 888 1.9e-19 SMART
low complexity region 890 902 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000184550
AA Change: H104R
Predicted Effect probably benign
Transcript: ENSMUST00000196469
SMART Domains Protein: ENSMUSP00000143601
Gene: ENSMUSG00000028163

DomainStartEndE-ValueType
Pfam:RHD_DNA_bind 42 90 2.5e-19 PFAM
Meta Mutation Damage Score 0.9479 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 100% (87/87)
MGI Phenotype Strain: 1857225
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 105 kD protein which can undergo cotranslational processing by the 26S proteasome to produce a 50 kD protein. The 105 kD protein is a Rel protein-specific transcription inhibitor and the 50 kD protein is a DNA binding subunit of the NF-kappa-B (NFKB) protein complex. NFKB is a transcription regulator that is activated by various intra- and extra-cellular stimuli such as cytokines, oxidant-free radicals, ultraviolet irradiation, and bacterial or viral products. Activated NFKB translocates into the nucleus and stimulates the expression of genes involved in a wide variety of biological functions. Inappropriate activation of NFKB has been associated with a number of inflammatory diseases while persistent inhibition of NFKB leads to inappropriate immune cell development or delayed cell growth. Alternative splicing results in multiple transcript variants encoding different isoforms, at least one of which is proteolytically processed. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous null mice have a decreased survivor rate, abnormal T cell development and decreased number of peripheral T cells, abnormal humoral responses with decreased immunoglobulin class switching, exhibit mild organ inflammation, and are susceptible toboth bacterial infections and hearing loss. [provided by MGI curators]
Allele List at MGI

All alleles(79) : Targeted(5) Gene trapped(74)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G A 17: 24,377,842 G423E probably damaging Het
Acox3 A T 5: 35,603,027 H429L probably damaging Het
Afg1l T A 10: 42,426,577 K142N probably damaging Het
Aldh1a7 T C 19: 20,727,461 I18V probably benign Het
Angel2 T C 1: 190,937,467 Y115H probably damaging Het
Bsg T G 10: 79,711,518 N261K probably damaging Het
C2cd2l A T 9: 44,316,775 V83E probably benign Het
Caml C A 13: 55,631,971 L286I probably benign Het
Ccdc125 A G 13: 100,693,573 I284V probably benign Het
Ces2a G A 8: 104,737,555 probably benign Het
Cfap61 T C 2: 146,035,319 probably null Het
Creg2 C T 1: 39,623,204 W253* probably null Het
Csmd3 T C 15: 47,696,789 T2293A probably damaging Het
Cttnbp2 A T 6: 18,434,983 I292K probably benign Het
Dab2ip T A 2: 35,720,278 M770K probably damaging Het
Dct T A 14: 118,034,251 D389V probably damaging Het
Dnah17 A T 11: 118,121,495 probably benign Het
Dnah6 T C 6: 73,124,778 E1921G probably benign Het
Ehmt1 A G 2: 24,877,464 S272P probably damaging Het
Ero1lb T C 13: 12,579,261 probably null Het
Fnip2 A G 3: 79,515,149 F108S probably benign Het
Foxb1 G A 9: 69,759,822 A142V probably damaging Het
Fras1 A T 5: 96,598,909 S613C probably damaging Het
Gm11639 A G 11: 104,721,114 K594R probably benign Het
Gm7276 C A 18: 77,185,570 probably benign Het
Gnb4 A C 3: 32,590,039 L152* probably null Het
H1fnt G T 15: 98,256,915 Q118K probably benign Het
Hdac7 A G 15: 97,806,525 L119P probably damaging Het
Hsd17b4 G A 18: 50,160,215 E274K probably benign Het
Htr4 T C 18: 62,412,234 I30T probably damaging Het
Ikzf2 T A 1: 69,538,814 Y512F probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Klhl22 C A 16: 17,776,488 D160E probably benign Het
Kpna6 T A 4: 129,657,471 R80S probably benign Het
Lclat1 A G 17: 73,188,004 E142G probably damaging Het
Lrig3 T C 10: 125,997,701 Y349H probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Map1b T A 13: 99,431,929 N1428I unknown Het
Map3k19 T A 1: 127,817,656 T1354S possibly damaging Het
Med13l T A 5: 118,749,748 W1696R probably damaging Het
Mfn1 T G 3: 32,534,322 V66G probably benign Het
Mllt10 A T 2: 18,208,790 Q459L possibly damaging Het
Morc2a G A 11: 3,675,885 V162M probably benign Het
Muc15 C T 2: 110,733,898 Q260* probably null Het
Nr2c1 T A 10: 94,188,183 W417R probably damaging Het
Olfr1279 T C 2: 111,306,771 C189R probably damaging Het
Olfr1285 T C 2: 111,408,753 Y113H probably damaging Het
Olfr1480 A T 19: 13,529,838 H99L probably damaging Het
Olfr250 C T 9: 38,367,566 H7Y probably benign Het
Olfr541 G T 7: 140,704,794 C181F probably damaging Het
Olfr714 T C 7: 107,074,274 S149P probably damaging Het
Pde10a A G 17: 8,898,870 D26G probably damaging Het
Pi15 G T 1: 17,621,502 C176F probably damaging Het
Pou2f2 T A 7: 25,092,724 T569S possibly damaging Het
Prf1 A C 10: 61,302,887 E208A probably benign Het
Prkd1 G A 12: 50,394,926 H277Y probably damaging Het
Rc3h1 T A 1: 160,959,423 V796E probably benign Het
Rgl1 T C 1: 152,533,575 Y503C probably damaging Het
Ripk3 T A 14: 55,786,351 H1L probably benign Het
Ryr1 C T 7: 29,036,078 D4064N probably damaging Het
Sec63 T A 10: 42,798,728 probably null Het
Slco1a4 T G 6: 141,839,577 M96L possibly damaging Het
Slit3 A T 11: 35,234,906 R137S possibly damaging Het
Smad1 T C 8: 79,372,029 E52G probably damaging Het
Srd5a2 A T 17: 74,021,481 W201R probably damaging Het
Steap1 A T 5: 5,736,498 L313Q probably damaging Het
Syt2 C A 1: 134,747,620 A403D probably damaging Het
Tax1bp1 T A 6: 52,736,912 S225R probably benign Het
Thap3 C T 4: 151,985,704 V78M probably damaging Het
Thoc5 A G 11: 4,919,792 K446R probably benign Het
Timmdc1 A C 16: 38,510,717 probably null Het
Tm6sf2 G T 8: 70,078,930 probably benign Het
Tmem126b G T 7: 90,475,971 A2E probably damaging Het
Trim9 T A 12: 70,255,113 R584W probably damaging Het
Ttn C A 2: 76,830,856 probably benign Het
Vmn1r25 A T 6: 57,978,461 I281N probably damaging Het
Wdr59 A G 8: 111,479,362 F553S probably damaging Het
Zc3h4 A G 7: 16,429,580 M575V unknown Het
Zfp53 A G 17: 21,509,504 T600A probably damaging Het
Zic5 A G 14: 122,459,527 S559P unknown Het
Other mutations in Nfkb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Nfkb1 APN 3 135590839 missense probably damaging 1.00
IGL01345:Nfkb1 APN 3 135594981 missense probably damaging 1.00
IGL01629:Nfkb1 APN 3 135601467 missense probably benign
IGL02216:Nfkb1 APN 3 135594963 missense probably damaging 0.98
IGL02273:Nfkb1 APN 3 135605207 missense probably benign 0.01
IGL02508:Nfkb1 APN 3 135590818 missense probably damaging 0.99
IGL03095:Nfkb1 APN 3 135618830 missense possibly damaging 0.48
Finlay UTSW 3 135595053 nonsense probably null
Frisbee UTSW 3 135613943 missense possibly damaging 0.93
kookaburra UTSW 3 135626611 nonsense probably null
Murgatroyd UTSW 3 135626710 missense possibly damaging 0.72
Poderoso UTSW 3 135613990 missense probably damaging 1.00
Puff UTSW 3 135595053 nonsense probably null
Roomba UTSW 3 135612412 critical splice donor site probably null
Wheelo UTSW 3 135615349 missense possibly damaging 0.81
R0026:Nfkb1 UTSW 3 135591573 missense probably damaging 1.00
R0047:Nfkb1 UTSW 3 135595053 nonsense probably null
R0989:Nfkb1 UTSW 3 135589396 missense probably benign 0.00
R1210:Nfkb1 UTSW 3 135594927 missense probably benign 0.03
R1661:Nfkb1 UTSW 3 135594957 missense probably damaging 1.00
R1725:Nfkb1 UTSW 3 135667758 missense probably damaging 1.00
R1984:Nfkb1 UTSW 3 135615349 missense possibly damaging 0.81
R1985:Nfkb1 UTSW 3 135615349 missense possibly damaging 0.81
R2154:Nfkb1 UTSW 3 135601479 missense probably benign 0.44
R2281:Nfkb1 UTSW 3 135601521 missense probably damaging 1.00
R2409:Nfkb1 UTSW 3 135613943 missense possibly damaging 0.93
R2504:Nfkb1 UTSW 3 135589329 missense possibly damaging 0.51
R4032:Nfkb1 UTSW 3 135594349 missense possibly damaging 0.63
R4232:Nfkb1 UTSW 3 135603770 missense probably damaging 1.00
R4936:Nfkb1 UTSW 3 135613982 missense probably damaging 0.97
R5085:Nfkb1 UTSW 3 135603807 missense probably benign 0.36
R5262:Nfkb1 UTSW 3 135612412 critical splice donor site probably null
R5384:Nfkb1 UTSW 3 135612542 missense possibly damaging 0.95
R5385:Nfkb1 UTSW 3 135612542 missense possibly damaging 0.95
R5434:Nfkb1 UTSW 3 135626611 nonsense probably null
R5663:Nfkb1 UTSW 3 135603851 missense possibly damaging 0.88
R5865:Nfkb1 UTSW 3 135603780 missense probably damaging 1.00
R6006:Nfkb1 UTSW 3 135603761 nonsense probably null
R6013:Nfkb1 UTSW 3 135626684 missense possibly damaging 0.86
R6234:Nfkb1 UTSW 3 135626710 missense possibly damaging 0.72
R6785:Nfkb1 UTSW 3 135615303 missense probably benign
R7175:Nfkb1 UTSW 3 135613990 missense probably damaging 1.00
R7227:Nfkb1 UTSW 3 135626659 missense probably damaging 1.00
R7394:Nfkb1 UTSW 3 135613697 missense possibly damaging 0.54
R7727:Nfkb1 UTSW 3 135585401 missense possibly damaging 0.48
X0050:Nfkb1 UTSW 3 135606623 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAAATGCCAAGCCCTTATGCTG -3'
(R):5'- CCGACTGTTGAATGCTGGTTCTCTC -3'

Sequencing Primer
(F):5'- TTCTGCTCTTGAGCAGGATG -3'
(R):5'- AGCTCCTTGAGTGACAAATGTCC -3'
Posted On2014-05-09