Incidental Mutation 'R1665:Ces2a'
ID 187114
Institutional Source Beutler Lab
Gene Symbol Ces2a
Ensembl Gene ENSMUSG00000055730
Gene Name carboxylesterase 2A
Synonyms 9130231C15Rik, Ces6
MMRRC Submission 039701-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.055) question?
Stock # R1665 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 105460635-105468266 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) G to A at 105464187 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034346] [ENSMUST00000161824] [ENSMUST00000164182]
AlphaFold Q8QZR3
Predicted Effect probably benign
Transcript: ENSMUST00000034346
SMART Domains Protein: ENSMUSP00000034346
Gene: ENSMUSG00000055730

DomainStartEndE-ValueType
Pfam:COesterase 9 537 1.2e-171 PFAM
Pfam:Abhydrolase_3 142 267 2.9e-11 PFAM
Pfam:Peptidase_S9 156 347 7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159303
Predicted Effect probably benign
Transcript: ENSMUST00000161824
Predicted Effect probably benign
Transcript: ENSMUST00000164182
SMART Domains Protein: ENSMUSP00000127346
Gene: ENSMUSG00000055730

DomainStartEndE-ValueType
Pfam:COesterase 8 276 5e-110 PFAM
Pfam:Abhydrolase_3 142 267 2.6e-11 PFAM
Pfam:Peptidase_S9 156 275 3e-7 PFAM
Pfam:COesterase 259 504 8.3e-47 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 100% (87/87)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G A 17: 24,596,816 (GRCm39) G423E probably damaging Het
Acox3 A T 5: 35,760,371 (GRCm39) H429L probably damaging Het
Afg1l T A 10: 42,302,573 (GRCm39) K142N probably damaging Het
Aldh1a7 T C 19: 20,704,825 (GRCm39) I18V probably benign Het
Angel2 T C 1: 190,669,664 (GRCm39) Y115H probably damaging Het
Bsg T G 10: 79,547,352 (GRCm39) N261K probably damaging Het
C2cd2l A T 9: 44,228,072 (GRCm39) V83E probably benign Het
Caml C A 13: 55,779,784 (GRCm39) L286I probably benign Het
Ccdc125 A G 13: 100,830,081 (GRCm39) I284V probably benign Het
Cfap61 T C 2: 145,877,239 (GRCm39) probably null Het
Creg2 C T 1: 39,662,372 (GRCm39) W253* probably null Het
Csmd3 T C 15: 47,560,185 (GRCm39) T2293A probably damaging Het
Cttnbp2 A T 6: 18,434,982 (GRCm39) I292K probably benign Het
Dab2ip T A 2: 35,610,290 (GRCm39) M770K probably damaging Het
Dct T A 14: 118,271,663 (GRCm39) D389V probably damaging Het
Dnah17 A T 11: 118,012,321 (GRCm39) probably benign Het
Dnah6 T C 6: 73,101,761 (GRCm39) E1921G probably benign Het
Efcab3 A G 11: 104,611,940 (GRCm39) K594R probably benign Het
Ehmt1 A G 2: 24,767,476 (GRCm39) S272P probably damaging Het
Ero1b T C 13: 12,594,142 (GRCm39) probably null Het
Fnip2 A G 3: 79,422,456 (GRCm39) F108S probably benign Het
Foxb1 G A 9: 69,667,104 (GRCm39) A142V probably damaging Het
Fras1 A T 5: 96,746,768 (GRCm39) S613C probably damaging Het
Gm7276 C A 18: 77,273,266 (GRCm39) probably benign Het
Gnb4 A C 3: 32,644,188 (GRCm39) L152* probably null Het
H1f7 G T 15: 98,154,796 (GRCm39) Q118K probably benign Het
Hdac7 A G 15: 97,704,406 (GRCm39) L119P probably damaging Het
Hsd17b4 G A 18: 50,293,282 (GRCm39) E274K probably benign Het
Htr4 T C 18: 62,545,305 (GRCm39) I30T probably damaging Het
Ikzf2 T A 1: 69,577,973 (GRCm39) Y512F probably damaging Het
Itga10 C T 3: 96,559,054 (GRCm39) probably benign Het
Klhl22 C A 16: 17,594,352 (GRCm39) D160E probably benign Het
Kpna6 T A 4: 129,551,264 (GRCm39) R80S probably benign Het
Lclat1 A G 17: 73,494,999 (GRCm39) E142G probably damaging Het
Lrig3 T C 10: 125,833,570 (GRCm39) Y349H probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,235,260 (GRCm39) probably null Het
Map1b T A 13: 99,568,437 (GRCm39) N1428I unknown Het
Map3k19 T A 1: 127,745,393 (GRCm39) T1354S possibly damaging Het
Med13l T A 5: 118,887,813 (GRCm39) W1696R probably damaging Het
Mfn1 T G 3: 32,588,471 (GRCm39) V66G probably benign Het
Mllt10 A T 2: 18,213,601 (GRCm39) Q459L possibly damaging Het
Morc2a G A 11: 3,625,885 (GRCm39) V162M probably benign Het
Muc15 C T 2: 110,564,243 (GRCm39) Q260* probably null Het
Nfkb1 T C 3: 135,300,718 (GRCm39) H616R probably damaging Het
Nr2c1 T A 10: 94,024,045 (GRCm39) W417R probably damaging Het
Or10a2 T C 7: 106,673,481 (GRCm39) S149P probably damaging Het
Or13a26 G T 7: 140,284,707 (GRCm39) C181F probably damaging Het
Or4g16 T C 2: 111,137,116 (GRCm39) C189R probably damaging Het
Or4k39 T C 2: 111,239,098 (GRCm39) Y113H probably damaging Het
Or5b121 A T 19: 13,507,202 (GRCm39) H99L probably damaging Het
Or8c10 C T 9: 38,278,862 (GRCm39) H7Y probably benign Het
Pde10a A G 17: 9,117,702 (GRCm39) D26G probably damaging Het
Pi15 G T 1: 17,691,726 (GRCm39) C176F probably damaging Het
Pou2f2 T A 7: 24,792,149 (GRCm39) T569S possibly damaging Het
Prf1 A C 10: 61,138,666 (GRCm39) E208A probably benign Het
Prkd1 G A 12: 50,441,709 (GRCm39) H277Y probably damaging Het
Rc3h1 T A 1: 160,786,993 (GRCm39) V796E probably benign Het
Rgl1 T C 1: 152,409,326 (GRCm39) Y503C probably damaging Het
Ripk3 T A 14: 56,023,808 (GRCm39) H1L probably benign Het
Ryr1 C T 7: 28,735,503 (GRCm39) D4064N probably damaging Het
Sec63 T A 10: 42,674,724 (GRCm39) probably null Het
Slco1a4 T G 6: 141,785,303 (GRCm39) M96L possibly damaging Het
Slit3 A T 11: 35,125,733 (GRCm39) R137S possibly damaging Het
Smad1 T C 8: 80,098,658 (GRCm39) E52G probably damaging Het
Srd5a2 A T 17: 74,328,476 (GRCm39) W201R probably damaging Het
Steap1 A T 5: 5,786,498 (GRCm39) L313Q probably damaging Het
Syt2 C A 1: 134,675,358 (GRCm39) A403D probably damaging Het
Tax1bp1 T A 6: 52,713,897 (GRCm39) S225R probably benign Het
Thap3 C T 4: 152,070,161 (GRCm39) V78M probably damaging Het
Thoc5 A G 11: 4,869,792 (GRCm39) K446R probably benign Het
Timmdc1 A C 16: 38,331,079 (GRCm39) probably null Het
Tm6sf2 G T 8: 70,531,580 (GRCm39) probably benign Het
Tmem126b G T 7: 90,125,179 (GRCm39) A2E probably damaging Het
Trim9 T A 12: 70,301,887 (GRCm39) R584W probably damaging Het
Ttn C A 2: 76,661,200 (GRCm39) probably benign Het
Vmn1r25 A T 6: 57,955,446 (GRCm39) I281N probably damaging Het
Wdr59 A G 8: 112,205,994 (GRCm39) F553S probably damaging Het
Zc3h4 A G 7: 16,163,505 (GRCm39) M575V unknown Het
Zfp53 A G 17: 21,729,766 (GRCm39) T600A probably damaging Het
Zic5 A G 14: 122,696,939 (GRCm39) S559P unknown Het
Other mutations in Ces2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01933:Ces2a APN 8 105,468,047 (GRCm39) makesense probably null
IGL02135:Ces2a APN 8 105,466,813 (GRCm39) missense probably benign 0.00
IGL02529:Ces2a APN 8 105,463,851 (GRCm39) splice site probably benign
IGL02625:Ces2a APN 8 105,466,910 (GRCm39) critical splice donor site probably null
IGL02869:Ces2a APN 8 105,465,691 (GRCm39) missense probably damaging 1.00
IGL03265:Ces2a APN 8 105,464,075 (GRCm39) missense possibly damaging 0.55
IGL03349:Ces2a APN 8 105,460,712 (GRCm39) missense probably damaging 0.99
R0010:Ces2a UTSW 8 105,468,028 (GRCm39) missense probably benign 0.00
R0318:Ces2a UTSW 8 105,467,456 (GRCm39) missense probably damaging 1.00
R0477:Ces2a UTSW 8 105,464,169 (GRCm39) missense probably damaging 0.99
R0561:Ces2a UTSW 8 105,464,165 (GRCm39) missense probably benign 0.35
R0619:Ces2a UTSW 8 105,462,742 (GRCm39) missense probably benign 0.00
R1737:Ces2a UTSW 8 105,467,456 (GRCm39) missense probably damaging 0.98
R2266:Ces2a UTSW 8 105,466,822 (GRCm39) missense probably benign 0.02
R2267:Ces2a UTSW 8 105,466,822 (GRCm39) missense probably benign 0.02
R2269:Ces2a UTSW 8 105,466,822 (GRCm39) missense probably benign 0.02
R2288:Ces2a UTSW 8 105,464,069 (GRCm39) missense probably damaging 1.00
R2656:Ces2a UTSW 8 105,462,766 (GRCm39) missense probably benign 0.00
R3176:Ces2a UTSW 8 105,466,010 (GRCm39) splice site probably benign
R3906:Ces2a UTSW 8 105,465,940 (GRCm39) missense probably benign 0.00
R4344:Ces2a UTSW 8 105,463,766 (GRCm39) missense probably damaging 1.00
R4708:Ces2a UTSW 8 105,463,938 (GRCm39) missense probably benign 0.14
R4780:Ces2a UTSW 8 105,463,840 (GRCm39) missense probably damaging 1.00
R5434:Ces2a UTSW 8 105,464,041 (GRCm39) missense probably damaging 0.98
R5763:Ces2a UTSW 8 105,462,756 (GRCm39) missense probably benign 0.00
R5828:Ces2a UTSW 8 105,465,956 (GRCm39) missense probably benign 0.00
R6359:Ces2a UTSW 8 105,462,710 (GRCm39) missense probably benign 0.00
R6440:Ces2a UTSW 8 105,467,954 (GRCm39) missense probably benign 0.12
R7066:Ces2a UTSW 8 105,466,880 (GRCm39) missense probably damaging 0.99
R7267:Ces2a UTSW 8 105,465,672 (GRCm39) missense probably benign 0.20
R7395:Ces2a UTSW 8 105,466,273 (GRCm39) missense probably benign 0.35
R7455:Ces2a UTSW 8 105,464,154 (GRCm39) missense probably damaging 1.00
R7457:Ces2a UTSW 8 105,464,021 (GRCm39) missense possibly damaging 0.87
R7567:Ces2a UTSW 8 105,467,930 (GRCm39) missense probably benign 0.01
R7683:Ces2a UTSW 8 105,463,744 (GRCm39) missense probably benign 0.00
R8328:Ces2a UTSW 8 105,463,998 (GRCm39) missense probably damaging 1.00
R8336:Ces2a UTSW 8 105,465,665 (GRCm39) missense probably damaging 0.97
R9183:Ces2a UTSW 8 105,460,774 (GRCm39) missense possibly damaging 0.95
R9794:Ces2a UTSW 8 105,467,896 (GRCm39) missense probably benign 0.16
X0022:Ces2a UTSW 8 105,462,774 (GRCm39) missense probably damaging 1.00
Z1176:Ces2a UTSW 8 105,461,482 (GRCm39) missense probably damaging 1.00
Z1176:Ces2a UTSW 8 105,460,638 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ATTTGGAGTCTCAGCAGGAGGTACA -3'
(R):5'- gCTACTCACAGGGGACAATAGGTATGAA -3'

Sequencing Primer
(F):5'- GGTACAAGTGTGTCTTCTCATATTC -3'
(R):5'- gatacacctgctccttccc -3'
Posted On 2014-05-09