Incidental Mutation 'R1665:Afg1l'
ID 187119
Institutional Source Beutler Lab
Gene Symbol Afg1l
Ensembl Gene ENSMUSG00000038302
Gene Name AFG1 like ATPase
Synonyms Lace1
MMRRC Submission 039701-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.151) question?
Stock # R1665 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 42312585-42478565 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 42426577 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 142 (K142N)
Ref Sequence ENSEMBL: ENSMUSP00000123510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041024] [ENSMUST00000133326]
AlphaFold Q3V384
Predicted Effect probably damaging
Transcript: ENSMUST00000041024
AA Change: K142N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036149
Gene: ENSMUSG00000038302
AA Change: K142N

DomainStartEndE-ValueType
low complexity region 21 32 N/A INTRINSIC
low complexity region 34 43 N/A INTRINSIC
Pfam:AFG1_ATPase 74 432 4.4e-110 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000133326
AA Change: K142N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123510
Gene: ENSMUSG00000038302
AA Change: K142N

DomainStartEndE-ValueType
low complexity region 21 32 N/A INTRINSIC
low complexity region 34 43 N/A INTRINSIC
Pfam:AFG1_ATPase 73 272 2e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149832
SMART Domains Protein: ENSMUSP00000119620
Gene: ENSMUSG00000038302

DomainStartEndE-ValueType
Pfam:AFG1_ATPase 2 80 5.3e-29 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000151747
AA Change: K9N
SMART Domains Protein: ENSMUSP00000120389
Gene: ENSMUSG00000038302
AA Change: K9N

DomainStartEndE-ValueType
Pfam:AFG1_ATPase 5 300 2e-97 PFAM
Meta Mutation Damage Score 0.5495 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial integral membrane protein that plays a role in mitochondrial protein homeostasis. The protein contains a P-loop motif and a five-domain structure that is conserved in fly, yeast, and bacteria. It functions to mediate the degradation of nuclear-encoded complex IV subunits. Two conserved estrogen receptor binding sites are located within 2.5 kb of this gene. Polymorphisms in this gene have been associated with bipolar disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G A 17: 24,377,842 G423E probably damaging Het
Acox3 A T 5: 35,603,027 H429L probably damaging Het
Aldh1a7 T C 19: 20,727,461 I18V probably benign Het
Angel2 T C 1: 190,937,467 Y115H probably damaging Het
Bsg T G 10: 79,711,518 N261K probably damaging Het
C2cd2l A T 9: 44,316,775 V83E probably benign Het
Caml C A 13: 55,631,971 L286I probably benign Het
Ccdc125 A G 13: 100,693,573 I284V probably benign Het
Ces2a G A 8: 104,737,555 probably benign Het
Cfap61 T C 2: 146,035,319 probably null Het
Creg2 C T 1: 39,623,204 W253* probably null Het
Csmd3 T C 15: 47,696,789 T2293A probably damaging Het
Cttnbp2 A T 6: 18,434,983 I292K probably benign Het
Dab2ip T A 2: 35,720,278 M770K probably damaging Het
Dct T A 14: 118,034,251 D389V probably damaging Het
Dnah17 A T 11: 118,121,495 probably benign Het
Dnah6 T C 6: 73,124,778 E1921G probably benign Het
Ehmt1 A G 2: 24,877,464 S272P probably damaging Het
Ero1lb T C 13: 12,579,261 probably null Het
Fnip2 A G 3: 79,515,149 F108S probably benign Het
Foxb1 G A 9: 69,759,822 A142V probably damaging Het
Fras1 A T 5: 96,598,909 S613C probably damaging Het
Gm11639 A G 11: 104,721,114 K594R probably benign Het
Gm7276 C A 18: 77,185,570 probably benign Het
Gnb4 A C 3: 32,590,039 L152* probably null Het
H1fnt G T 15: 98,256,915 Q118K probably benign Het
Hdac7 A G 15: 97,806,525 L119P probably damaging Het
Hsd17b4 G A 18: 50,160,215 E274K probably benign Het
Htr4 T C 18: 62,412,234 I30T probably damaging Het
Ikzf2 T A 1: 69,538,814 Y512F probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Klhl22 C A 16: 17,776,488 D160E probably benign Het
Kpna6 T A 4: 129,657,471 R80S probably benign Het
Lclat1 A G 17: 73,188,004 E142G probably damaging Het
Lrig3 T C 10: 125,997,701 Y349H probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Map1b T A 13: 99,431,929 N1428I unknown Het
Map3k19 T A 1: 127,817,656 T1354S possibly damaging Het
Med13l T A 5: 118,749,748 W1696R probably damaging Het
Mfn1 T G 3: 32,534,322 V66G probably benign Het
Mllt10 A T 2: 18,208,790 Q459L possibly damaging Het
Morc2a G A 11: 3,675,885 V162M probably benign Het
Muc15 C T 2: 110,733,898 Q260* probably null Het
Nfkb1 T C 3: 135,594,957 H616R probably damaging Het
Nr2c1 T A 10: 94,188,183 W417R probably damaging Het
Olfr1279 T C 2: 111,306,771 C189R probably damaging Het
Olfr1285 T C 2: 111,408,753 Y113H probably damaging Het
Olfr1480 A T 19: 13,529,838 H99L probably damaging Het
Olfr250 C T 9: 38,367,566 H7Y probably benign Het
Olfr541 G T 7: 140,704,794 C181F probably damaging Het
Olfr714 T C 7: 107,074,274 S149P probably damaging Het
Pde10a A G 17: 8,898,870 D26G probably damaging Het
Pi15 G T 1: 17,621,502 C176F probably damaging Het
Pou2f2 T A 7: 25,092,724 T569S possibly damaging Het
Prf1 A C 10: 61,302,887 E208A probably benign Het
Prkd1 G A 12: 50,394,926 H277Y probably damaging Het
Rc3h1 T A 1: 160,959,423 V796E probably benign Het
Rgl1 T C 1: 152,533,575 Y503C probably damaging Het
Ripk3 T A 14: 55,786,351 H1L probably benign Het
Ryr1 C T 7: 29,036,078 D4064N probably damaging Het
Sec63 T A 10: 42,798,728 probably null Het
Slco1a4 T G 6: 141,839,577 M96L possibly damaging Het
Slit3 A T 11: 35,234,906 R137S possibly damaging Het
Smad1 T C 8: 79,372,029 E52G probably damaging Het
Srd5a2 A T 17: 74,021,481 W201R probably damaging Het
Steap1 A T 5: 5,736,498 L313Q probably damaging Het
Syt2 C A 1: 134,747,620 A403D probably damaging Het
Tax1bp1 T A 6: 52,736,912 S225R probably benign Het
Thap3 C T 4: 151,985,704 V78M probably damaging Het
Thoc5 A G 11: 4,919,792 K446R probably benign Het
Timmdc1 A C 16: 38,510,717 probably null Het
Tm6sf2 G T 8: 70,078,930 probably benign Het
Tmem126b G T 7: 90,475,971 A2E probably damaging Het
Trim9 T A 12: 70,255,113 R584W probably damaging Het
Ttn C A 2: 76,830,856 probably benign Het
Vmn1r25 A T 6: 57,978,461 I281N probably damaging Het
Wdr59 A G 8: 111,479,362 F553S probably damaging Het
Zc3h4 A G 7: 16,429,580 M575V unknown Het
Zfp53 A G 17: 21,509,504 T600A probably damaging Het
Zic5 A G 14: 122,459,527 S559P unknown Het
Other mutations in Afg1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01863:Afg1l APN 10 42339911 missense possibly damaging 0.86
IGL02041:Afg1l APN 10 42454380 missense probably damaging 0.98
IGL02309:Afg1l APN 10 42454378 missense possibly damaging 0.90
IGL02323:Afg1l APN 10 42454510 nonsense probably null
IGL03088:Afg1l APN 10 42426497 missense probably damaging 1.00
PIT4458001:Afg1l UTSW 10 42454370 nonsense probably null
R0969:Afg1l UTSW 10 42318621 missense probably damaging 1.00
R1703:Afg1l UTSW 10 42400399 missense probably damaging 1.00
R1766:Afg1l UTSW 10 42454495 missense probably benign 0.00
R2941:Afg1l UTSW 10 42478295 splice site probably null
R4846:Afg1l UTSW 10 42454494 missense probably benign 0.02
R4887:Afg1l UTSW 10 42454378 missense probably benign 0.00
R5668:Afg1l UTSW 10 42360240 missense probably damaging 1.00
R5934:Afg1l UTSW 10 42318686 missense probably damaging 1.00
R6575:Afg1l UTSW 10 42318716 missense probably damaging 1.00
R6972:Afg1l UTSW 10 42478374 missense probably benign 0.00
R7270:Afg1l UTSW 10 42425249 missense probably damaging 1.00
R7271:Afg1l UTSW 10 42415548 critical splice donor site probably null
R7577:Afg1l UTSW 10 42318611 missense probably damaging 1.00
R8458:Afg1l UTSW 10 42426521 missense probably damaging 0.98
R8824:Afg1l UTSW 10 42438387 missense possibly damaging 0.49
R9032:Afg1l UTSW 10 42318641 missense probably damaging 1.00
R9085:Afg1l UTSW 10 42318641 missense probably damaging 1.00
R9443:Afg1l UTSW 10 42313591 missense probably damaging 1.00
Z1176:Afg1l UTSW 10 42478353 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ATCTCACTTCCAGCAGAAGCCTCG -3'
(R):5'- TCCTCCATCAGAGCAGAGCTACAG -3'

Sequencing Primer
(F):5'- CAGAAGCCTCGGTTTTTTGTTTG -3'
(R):5'- GAGCAGAGCTACAGCCTCC -3'
Posted On 2014-05-09