Incidental Mutation 'R1666:Rbl1'
ID187168
Institutional Source Beutler Lab
Gene Symbol Rbl1
Ensembl Gene ENSMUSG00000027641
Gene NameRB transcriptional corepressor like 1
Synonymsp107
MMRRC Submission 039702-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1666 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location157145893-157204534 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 157159734 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 878 (Y878C)
Ref Sequence ENSEMBL: ENSMUSP00000029170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029170]
Predicted Effect probably damaging
Transcript: ENSMUST00000029170
AA Change: Y878C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029170
Gene: ENSMUSG00000027641
AA Change: Y878C

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
DUF3452 70 212 5.14e-78 SMART
RB_A 385 578 9.58e-119 SMART
low complexity region 706 719 N/A INTRINSIC
CYCLIN 800 934 8.68e-6 SMART
Rb_C 947 1063 2.29e-11 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar in sequence and possibly function to the product of the retinoblastoma 1 (RB1) gene. The RB1 gene product is a tumor suppressor protein that appears to be involved in cell cycle regulation, as it is phosphorylated in the S to M phase transition and is dephosphorylated in the G1 phase of the cell cycle. Both the RB1 protein and the product of this gene can form a complex with adenovirus E1A protein and SV40 large T-antigen, with the SV40 large T-antigen binding only to the unphosphorylated form of each protein. In addition, both proteins can inhibit the transcription of cell cycle genes containing E2F binding sites in their promoters. Due to the sequence and biochemical similarities with the RB1 protein, it is thought that the protein encoded by this gene may also be a tumor suppressor. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations are viable and fertile, but may show impaired growth, myeloid hyperplasia in spleen and liver and give rise to cells with a 2X doubling time in vitro. These effects are genetic background dependent. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A G 3: 108,469,997 S434P probably benign Het
Acvrl1 G A 15: 101,137,577 R328H probably damaging Het
Afp T C 5: 90,505,068 S466P probably damaging Het
Arhgap45 A G 10: 80,028,750 S879G possibly damaging Het
Asic1 A G 15: 99,699,125 D556G probably damaging Het
Atp2a3 T A 11: 72,978,807 probably null Het
Brinp2 C A 1: 158,246,558 E664D probably damaging Het
Cap2 C A 13: 46,615,323 H147N probably damaging Het
Cd209f G A 8: 4,104,862 Q79* probably null Het
Chrna7 T C 7: 63,212,142 Y54C possibly damaging Het
Clec1a T C 6: 129,437,004 D40G probably benign Het
Col11a1 A G 3: 114,061,535 E148G unknown Het
Comp A T 8: 70,378,957 probably null Het
Cpz A G 5: 35,508,116 probably null Het
Cyfip1 T A 7: 55,871,898 N13K probably damaging Het
Cyp2c50 A T 19: 40,091,055 M198L probably benign Het
Deup1 A T 9: 15,575,191 Y398N possibly damaging Het
Epb41l4a A G 18: 33,921,909 L42P probably damaging Het
Exo1 T C 1: 175,908,486 I812T possibly damaging Het
Fbxl17 A T 17: 63,385,065 probably null Het
Fxn A G 19: 24,262,013 Y172H probably damaging Het
Gabra6 A G 11: 42,317,634 S124P probably damaging Het
Gje1 C A 10: 14,716,807 W77L possibly damaging Het
Glra1 A G 11: 55,574,399 S23P probably damaging Het
Gm6614 T A 6: 141,982,049 probably null Het
Gm6811 T C 17: 21,094,267 noncoding transcript Het
Greb1l T A 18: 10,501,080 probably null Het
Greb1l T C 18: 10,529,708 probably null Het
Grm6 A T 11: 50,859,884 I625F probably damaging Het
Guca1a A G 17: 47,400,242 F60L probably damaging Het
Hectd1 T A 12: 51,753,824 E2070D possibly damaging Het
Itga5 G A 15: 103,347,902 T910I probably benign Het
Kctd10 A G 5: 114,368,990 V142A probably benign Het
Kif1c C T 11: 70,728,397 L953F probably damaging Het
Lmtk3 A T 7: 45,794,164 D757V probably benign Het
Lpcat1 T C 13: 73,510,123 probably null Het
Lrrc30 A T 17: 67,632,205 C127S probably benign Het
Mc4r A G 18: 66,859,409 L211P probably damaging Het
Mettl7a3 A G 15: 100,335,218 I97V probably benign Het
Mgat5b T A 11: 116,983,648 N635K probably benign Het
Mms19 A T 19: 41,952,556 M443K possibly damaging Het
Mroh5 T C 15: 73,787,905 N359S probably benign Het
Nlrc4 G A 17: 74,445,906 T494M probably damaging Het
Ntf3 T C 6: 126,102,438 D35G possibly damaging Het
Olfr1002 A T 2: 85,647,813 C169* probably null Het
Osbpl5 T C 7: 143,709,039 H192R probably damaging Het
Parp4 A T 14: 56,624,163 K984N possibly damaging Het
Pdgfra G A 5: 75,189,020 G892D possibly damaging Het
Pik3c2g A T 6: 139,635,636 probably benign Het
Ppcdc T A 9: 57,414,715 M181L possibly damaging Het
Pramel7 G A 2: 87,492,403 P6S probably damaging Het
Prkcz G T 4: 155,289,751 F69L probably damaging Het
Prkd1 G A 12: 50,394,926 H277Y probably damaging Het
Ptgs2 A G 1: 150,101,270 Y44C probably damaging Het
Rbck1 T A 2: 152,316,899 S488C probably damaging Het
Rbm6 G A 9: 107,791,856 T619I probably benign Het
Rp1 A G 1: 4,349,863 I342T probably damaging Het
Rpn2 C T 2: 157,294,155 T161M possibly damaging Het
Rufy4 G A 1: 74,147,678 V542I probably benign Het
Sema5b C T 16: 35,658,482 P559S probably benign Het
Serpinb3d A G 1: 107,080,751 V128A probably benign Het
Slc35f3 T A 8: 126,389,221 S296T probably damaging Het
Smarca2 A G 19: 26,647,034 I365V possibly damaging Het
Spdya T A 17: 71,578,240 C230S probably damaging Het
Sv2b G A 7: 75,206,341 A67V probably benign Het
Tapbpl A G 6: 125,230,201 V175A probably benign Het
Ttn T C 2: 76,811,751 T13373A probably damaging Het
Tubb5 A T 17: 35,836,638 N52K probably benign Het
Tyr T A 7: 87,492,941 Y137F probably damaging Het
Unc45b T A 11: 82,917,739 I217N probably benign Het
Vmn1r202 A T 13: 22,501,370 D292E possibly damaging Het
Vmn1r22 A G 6: 57,900,719 M91T probably benign Het
Washc2 T A 6: 116,223,254 probably null Het
Zfp566 A T 7: 30,078,476 H93Q probably benign Het
Zfp740 A G 15: 102,208,318 D56G probably damaging Het
Zfp804b A C 5: 6,771,323 L580R possibly damaging Het
Zmiz2 T G 11: 6,396,836 S148R probably benign Het
Zmym6 T A 4: 127,122,859 I719N probably damaging Het
Zyx T A 6: 42,356,032 V372E possibly damaging Het
Other mutations in Rbl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Rbl1 APN 2 157152892 splice site probably null
IGL01418:Rbl1 APN 2 157152892 splice site probably null
IGL01597:Rbl1 APN 2 157195449 splice site probably benign
IGL01788:Rbl1 APN 2 157163656 missense probably benign 0.15
IGL02366:Rbl1 APN 2 157174893 missense probably benign 0.18
IGL02527:Rbl1 APN 2 157194048 missense probably benign 0.05
IGL02720:Rbl1 APN 2 157199429 missense possibly damaging 0.94
IGL02828:Rbl1 APN 2 157199464 missense probably damaging 1.00
IGL02926:Rbl1 APN 2 157167413 missense probably benign 0.08
IGL02968:Rbl1 APN 2 157177274 missense probably damaging 1.00
IGL03284:Rbl1 APN 2 157194069 splice site probably benign
R0042:Rbl1 UTSW 2 157175704 splice site probably benign
R0089:Rbl1 UTSW 2 157199414 critical splice donor site probably null
R0173:Rbl1 UTSW 2 157159685 missense probably benign 0.00
R0464:Rbl1 UTSW 2 157147545 missense probably damaging 1.00
R1178:Rbl1 UTSW 2 157147655 missense possibly damaging 0.92
R1296:Rbl1 UTSW 2 157169971 missense probably benign 0.09
R1430:Rbl1 UTSW 2 157169906 missense probably benign
R1445:Rbl1 UTSW 2 157193098 missense probably benign
R1511:Rbl1 UTSW 2 157195634 missense probably damaging 1.00
R1603:Rbl1 UTSW 2 157175659 missense possibly damaging 0.75
R1668:Rbl1 UTSW 2 157159734 missense probably damaging 1.00
R1680:Rbl1 UTSW 2 157174783 missense probably damaging 0.97
R1771:Rbl1 UTSW 2 157163534 splice site probably null
R1833:Rbl1 UTSW 2 157195555 missense probably damaging 0.98
R1852:Rbl1 UTSW 2 157174903 missense probably benign 0.01
R2304:Rbl1 UTSW 2 157147631 missense probably benign 0.02
R3552:Rbl1 UTSW 2 157195585 missense probably benign 0.19
R3605:Rbl1 UTSW 2 157177233 missense probably damaging 1.00
R3607:Rbl1 UTSW 2 157177233 missense probably damaging 1.00
R4160:Rbl1 UTSW 2 157192119 intron probably benign
R4423:Rbl1 UTSW 2 157168955 intron probably benign
R4636:Rbl1 UTSW 2 157167420 missense possibly damaging 0.82
R4780:Rbl1 UTSW 2 157174804 missense probably benign 0.43
R4789:Rbl1 UTSW 2 157177355 missense probably benign
R5145:Rbl1 UTSW 2 157175477 intron probably benign
R5802:Rbl1 UTSW 2 157161433 missense probably benign 0.23
R5851:Rbl1 UTSW 2 157167325 missense probably benign 0.00
R6742:Rbl1 UTSW 2 157169998 missense probably benign 0.19
R6861:Rbl1 UTSW 2 157152967 missense probably damaging 1.00
R6943:Rbl1 UTSW 2 157188286 missense probably benign
R7090:Rbl1 UTSW 2 157152900 missense probably benign 0.02
R7176:Rbl1 UTSW 2 157188325 missense probably damaging 1.00
X0057:Rbl1 UTSW 2 157188329 nonsense probably null
X0058:Rbl1 UTSW 2 157174813 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- tctctctctctcCTTACACAGCCAC -3'
(R):5'- TGGAACACAGTCTAGAAGAGGCCC -3'

Sequencing Primer
(F):5'- tctcCTTACACAGCCACTTTCAC -3'
(R):5'- gaggcagaggcaggtgg -3'
Posted On2014-05-09