Incidental Mutation 'R1666:Pdgfra'
ID187178
Institutional Source Beutler Lab
Gene Symbol Pdgfra
Ensembl Gene ENSMUSG00000029231
Gene Nameplatelet derived growth factor receptor, alpha polypeptide
SynonymsPdgfr-2, CD140a
MMRRC Submission 039702-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1666 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location75152292-75198215 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 75189020 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 892 (G892D)
Ref Sequence ENSEMBL: ENSMUSP00000127173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000476] [ENSMUST00000168162] [ENSMUST00000201711]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000476
AA Change: G892D

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000000476
Gene: ENSMUSG00000029231
AA Change: G892D

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 34 122 6.07e-3 SMART
IG_like 135 206 1.7e1 SMART
IGc2 226 297 8.72e-4 SMART
IG 322 414 2.86e0 SMART
transmembrane domain 527 549 N/A INTRINSIC
TyrKc 593 950 8.51e-141 SMART
Blast:TyrKc 960 991 3e-8 BLAST
low complexity region 1063 1082 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000168162
AA Change: G892D

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127173
Gene: ENSMUSG00000029231
AA Change: G892D

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 34 122 6.07e-3 SMART
IG_like 135 206 1.7e1 SMART
IGc2 226 297 8.72e-4 SMART
IG 322 414 2.86e0 SMART
transmembrane domain 527 549 N/A INTRINSIC
TyrKc 593 950 8.51e-141 SMART
Blast:TyrKc 960 991 3e-8 BLAST
low complexity region 1063 1082 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201711
SMART Domains Protein: ENSMUSP00000143891
Gene: ENSMUSG00000029231

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 34 122 6.07e-3 SMART
IG_like 135 206 1.7e1 SMART
IGc2 226 297 8.72e-4 SMART
IG 322 414 2.86e0 SMART
transmembrane domain 527 549 N/A INTRINSIC
Pfam:Pkinase 593 701 9.9e-14 PFAM
Pfam:Pkinase_Tyr 593 750 5.2e-32 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the receptor tyrosine kinase family of proteins. Binding of platelet-derived growth factor protein ligands to this receptor triggers receptor dimerization and autophosphorylation, resulting in the activation of several downstream signaling pathways. Signaling through the encoded receptor plays a role in gastrulation and the development of nearly all organ systems. Mice lacking a functional copy of this gene reportedly exhibit defects in lung, skeleton, testis and the central nervous system, and die soon after birth. Alternative splicing and intronic polyadenylation of gene transcripts have been implicated in muscle regeneration and fibrosis in adult mice. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygotes for targeted null mutations exhibit incomplete cephalic closure, increased apoptosis of neural crest cells, impaired myotome and testis formation, abnormal mucosal linings, thoracic skeletal defects, and midgestational lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A G 3: 108,469,997 S434P probably benign Het
Acvrl1 G A 15: 101,137,577 R328H probably damaging Het
Afp T C 5: 90,505,068 S466P probably damaging Het
Arhgap45 A G 10: 80,028,750 S879G possibly damaging Het
Asic1 A G 15: 99,699,125 D556G probably damaging Het
Atp2a3 T A 11: 72,978,807 probably null Het
Brinp2 C A 1: 158,246,558 E664D probably damaging Het
Cap2 C A 13: 46,615,323 H147N probably damaging Het
Cd209f G A 8: 4,104,862 Q79* probably null Het
Chrna7 T C 7: 63,212,142 Y54C possibly damaging Het
Clec1a T C 6: 129,437,004 D40G probably benign Het
Col11a1 A G 3: 114,061,535 E148G unknown Het
Comp A T 8: 70,378,957 probably null Het
Cpz A G 5: 35,508,116 probably null Het
Cyfip1 T A 7: 55,871,898 N13K probably damaging Het
Cyp2c50 A T 19: 40,091,055 M198L probably benign Het
Deup1 A T 9: 15,575,191 Y398N possibly damaging Het
Epb41l4a A G 18: 33,921,909 L42P probably damaging Het
Exo1 T C 1: 175,908,486 I812T possibly damaging Het
Fbxl17 A T 17: 63,385,065 probably null Het
Fxn A G 19: 24,262,013 Y172H probably damaging Het
Gabra6 A G 11: 42,317,634 S124P probably damaging Het
Gje1 C A 10: 14,716,807 W77L possibly damaging Het
Glra1 A G 11: 55,574,399 S23P probably damaging Het
Gm6614 T A 6: 141,982,049 probably null Het
Gm6811 T C 17: 21,094,267 noncoding transcript Het
Greb1l T A 18: 10,501,080 probably null Het
Greb1l T C 18: 10,529,708 probably null Het
Grm6 A T 11: 50,859,884 I625F probably damaging Het
Guca1a A G 17: 47,400,242 F60L probably damaging Het
Hectd1 T A 12: 51,753,824 E2070D possibly damaging Het
Itga5 G A 15: 103,347,902 T910I probably benign Het
Kctd10 A G 5: 114,368,990 V142A probably benign Het
Kif1c C T 11: 70,728,397 L953F probably damaging Het
Lmtk3 A T 7: 45,794,164 D757V probably benign Het
Lpcat1 T C 13: 73,510,123 probably null Het
Lrrc30 A T 17: 67,632,205 C127S probably benign Het
Mc4r A G 18: 66,859,409 L211P probably damaging Het
Mettl7a3 A G 15: 100,335,218 I97V probably benign Het
Mgat5b T A 11: 116,983,648 N635K probably benign Het
Mms19 A T 19: 41,952,556 M443K possibly damaging Het
Mroh5 T C 15: 73,787,905 N359S probably benign Het
Nlrc4 G A 17: 74,445,906 T494M probably damaging Het
Ntf3 T C 6: 126,102,438 D35G possibly damaging Het
Olfr1002 A T 2: 85,647,813 C169* probably null Het
Osbpl5 T C 7: 143,709,039 H192R probably damaging Het
Parp4 A T 14: 56,624,163 K984N possibly damaging Het
Pik3c2g A T 6: 139,635,636 probably benign Het
Ppcdc T A 9: 57,414,715 M181L possibly damaging Het
Pramel7 G A 2: 87,492,403 P6S probably damaging Het
Prkcz G T 4: 155,289,751 F69L probably damaging Het
Prkd1 G A 12: 50,394,926 H277Y probably damaging Het
Ptgs2 A G 1: 150,101,270 Y44C probably damaging Het
Rbck1 T A 2: 152,316,899 S488C probably damaging Het
Rbl1 T C 2: 157,159,734 Y878C probably damaging Het
Rbm6 G A 9: 107,791,856 T619I probably benign Het
Rp1 A G 1: 4,349,863 I342T probably damaging Het
Rpn2 C T 2: 157,294,155 T161M possibly damaging Het
Rufy4 G A 1: 74,147,678 V542I probably benign Het
Sema5b C T 16: 35,658,482 P559S probably benign Het
Serpinb3d A G 1: 107,080,751 V128A probably benign Het
Slc35f3 T A 8: 126,389,221 S296T probably damaging Het
Smarca2 A G 19: 26,647,034 I365V possibly damaging Het
Spdya T A 17: 71,578,240 C230S probably damaging Het
Sv2b G A 7: 75,206,341 A67V probably benign Het
Tapbpl A G 6: 125,230,201 V175A probably benign Het
Ttn T C 2: 76,811,751 T13373A probably damaging Het
Tubb5 A T 17: 35,836,638 N52K probably benign Het
Tyr T A 7: 87,492,941 Y137F probably damaging Het
Unc45b T A 11: 82,917,739 I217N probably benign Het
Vmn1r202 A T 13: 22,501,370 D292E possibly damaging Het
Vmn1r22 A G 6: 57,900,719 M91T probably benign Het
Washc2 T A 6: 116,223,254 probably null Het
Zfp566 A T 7: 30,078,476 H93Q probably benign Het
Zfp740 A G 15: 102,208,318 D56G probably damaging Het
Zfp804b A C 5: 6,771,323 L580R possibly damaging Het
Zmiz2 T G 11: 6,396,836 S148R probably benign Het
Zmym6 T A 4: 127,122,859 I719N probably damaging Het
Zyx T A 6: 42,356,032 V372E possibly damaging Het
Other mutations in Pdgfra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Pdgfra APN 5 75163679 missense probably benign 0.40
IGL00574:Pdgfra APN 5 75181047 missense probably damaging 1.00
IGL00906:Pdgfra APN 5 75180173 missense probably benign 0.00
IGL00964:Pdgfra APN 5 75175065 missense probably damaging 1.00
IGL01467:Pdgfra APN 5 75185631 critical splice donor site probably null
IGL01485:Pdgfra APN 5 75163652 missense probably benign 0.02
IGL01556:Pdgfra APN 5 75177691 missense probably damaging 1.00
IGL01949:Pdgfra APN 5 75170665 missense probably damaging 0.98
IGL02066:Pdgfra APN 5 75170580 missense possibly damaging 0.55
IGL02271:Pdgfra APN 5 75187906 missense probably damaging 1.00
IGL02726:Pdgfra APN 5 75194957 nonsense probably null
IGL02858:Pdgfra APN 5 75194974 missense probably damaging 1.00
IGL03306:Pdgfra APN 5 75192533 missense possibly damaging 0.49
Pony_express UTSW 5 75189234 nonsense probably null
P0033:Pdgfra UTSW 5 75192561 missense probably damaging 1.00
PIT4472001:Pdgfra UTSW 5 75180246 missense probably damaging 1.00
R0134:Pdgfra UTSW 5 75166511 missense probably damaging 1.00
R0200:Pdgfra UTSW 5 75163777 missense probably damaging 1.00
R0254:Pdgfra UTSW 5 75167935 missense probably damaging 1.00
R0331:Pdgfra UTSW 5 75195052 missense probably damaging 1.00
R0467:Pdgfra UTSW 5 75195036 missense probably damaging 1.00
R0532:Pdgfra UTSW 5 75170773 missense probably benign 0.00
R0608:Pdgfra UTSW 5 75163777 missense probably damaging 1.00
R0765:Pdgfra UTSW 5 75187987 unclassified probably benign
R1171:Pdgfra UTSW 5 75173447 missense probably damaging 0.98
R1372:Pdgfra UTSW 5 75189263 missense probably damaging 0.96
R1530:Pdgfra UTSW 5 75189010 splice site probably null
R1585:Pdgfra UTSW 5 75192603 missense probably damaging 1.00
R1836:Pdgfra UTSW 5 75183014 missense possibly damaging 0.95
R1868:Pdgfra UTSW 5 75170873 missense probably benign 0.43
R1923:Pdgfra UTSW 5 75163733 missense probably benign 0.03
R2075:Pdgfra UTSW 5 75187948 missense probably damaging 1.00
R2261:Pdgfra UTSW 5 75185523 missense probably benign 0.03
R2262:Pdgfra UTSW 5 75185523 missense probably benign 0.03
R3028:Pdgfra UTSW 5 75174981 missense probably damaging 1.00
R3236:Pdgfra UTSW 5 75167936 missense probably damaging 1.00
R3692:Pdgfra UTSW 5 75189287 missense possibly damaging 0.54
R3701:Pdgfra UTSW 5 75180220 nonsense probably null
R3890:Pdgfra UTSW 5 75167927 missense probably null 0.57
R3901:Pdgfra UTSW 5 75192508 missense probably benign 0.10
R3902:Pdgfra UTSW 5 75192508 missense probably benign 0.10
R4272:Pdgfra UTSW 5 75183070 missense probably benign 0.05
R4532:Pdgfra UTSW 5 75181083 missense probably damaging 1.00
R4660:Pdgfra UTSW 5 75162271 missense possibly damaging 0.82
R4753:Pdgfra UTSW 5 75181524 missense probably damaging 1.00
R4795:Pdgfra UTSW 5 75189311 missense probably benign
R4796:Pdgfra UTSW 5 75189311 missense probably benign
R4884:Pdgfra UTSW 5 75189312 missense probably benign 0.07
R4936:Pdgfra UTSW 5 75195026 missense probably damaging 1.00
R5625:Pdgfra UTSW 5 75189337 critical splice donor site probably null
R5666:Pdgfra UTSW 5 75173495 missense probably benign 0.00
R5670:Pdgfra UTSW 5 75173495 missense probably benign 0.00
R5714:Pdgfra UTSW 5 75186012 missense probably damaging 1.00
R5836:Pdgfra UTSW 5 75163774 missense possibly damaging 0.52
R6126:Pdgfra UTSW 5 75170529 missense probably benign 0.09
R6141:Pdgfra UTSW 5 75173396 missense probably damaging 0.98
R6297:Pdgfra UTSW 5 75173474 missense possibly damaging 0.88
R6363:Pdgfra UTSW 5 75170836 missense possibly damaging 0.91
R6376:Pdgfra UTSW 5 75166519 missense probably benign 0.02
R6485:Pdgfra UTSW 5 75175074 splice site probably null
R6612:Pdgfra UTSW 5 75167842 missense probably benign 0.01
R6641:Pdgfra UTSW 5 75162101 intron probably benign
R6954:Pdgfra UTSW 5 75173394 missense possibly damaging 0.82
R7110:Pdgfra UTSW 5 75189234 nonsense probably null
R7192:Pdgfra UTSW 5 75183106 missense probably damaging 1.00
R7294:Pdgfra UTSW 5 75181651 missense probably benign 0.05
R7347:Pdgfra UTSW 5 75183098 missense possibly damaging 0.91
R7476:Pdgfra UTSW 5 75170603 missense probably damaging 1.00
R7512:Pdgfra UTSW 5 75195014 nonsense probably null
R7609:Pdgfra UTSW 5 75166721 missense probably benign 0.10
R7925:Pdgfra UTSW 5 75192418 splice site probably benign
R8141:Pdgfra UTSW 5 75177726 missense possibly damaging 0.81
Z1088:Pdgfra UTSW 5 75166577 missense probably benign 0.03
Z1177:Pdgfra UTSW 5 75181674 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- CGCTTGGATTTAGTCACCCAAGACC -3'
(R):5'- CCAGCACTGCACCATGATCTCATAG -3'

Sequencing Primer
(F):5'- TTTAGTCACCCAAGACCGCTATG -3'
(R):5'- CTCAGAGTGAGTGTGGGC -3'
Posted On2014-05-09