Incidental Mutation 'R1666:Cyfip1'
ID187193
Institutional Source Beutler Lab
Gene Symbol Cyfip1
Ensembl Gene ENSMUSG00000030447
Gene Namecytoplasmic FMR1 interacting protein 1
Synonymsl(7)1Rl, pl-1, P140SRA-1, l7Rl1, Sra-1, Shyc, E030028J09Rik
MMRRC Submission 039702-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1666 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location55841745-55932602 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55871898 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 13 (N13K)
Ref Sequence ENSEMBL: ENSMUSP00000082353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032629] [ENSMUST00000085255] [ENSMUST00000163845] [ENSMUST00000173783] [ENSMUST00000206862]
Predicted Effect probably damaging
Transcript: ENSMUST00000032629
AA Change: N13K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032629
Gene: ENSMUSG00000030447
AA Change: N13K

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:DUF1394 59 302 5.7e-11 PFAM
Pfam:FragX_IP 389 1222 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000085255
AA Change: N13K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000082353
Gene: ENSMUSG00000030447
AA Change: N13K

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:FragX_IP 385 1222 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163845
AA Change: N13K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127717
Gene: ENSMUSG00000030447
AA Change: N13K

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:FragX_IP 385 1224 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168271
SMART Domains Protein: ENSMUSP00000131596
Gene: ENSMUSG00000030447

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:DUF1394 57 267 1.8e-9 PFAM
low complexity region 390 403 N/A INTRINSIC
low complexity region 411 428 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173497
Predicted Effect possibly damaging
Transcript: ENSMUST00000173783
AA Change: N13K

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134509
Gene: ENSMUSG00000030447
AA Change: N13K

DomainStartEndE-ValueType
PDB:4N78|A 1 230 1e-142 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000206862
AA Change: N13K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutations at this locus result in embryonic lethality before the turning stage in homozygotes. Heterozygotes exhibit abnormal synaptic transmission. Parental origin of the mutant allele in heterozygotes has an effect on long term depression, cued fear conditioning, anxiety, and activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A G 3: 108,469,997 S434P probably benign Het
Acvrl1 G A 15: 101,137,577 R328H probably damaging Het
Afp T C 5: 90,505,068 S466P probably damaging Het
Arhgap45 A G 10: 80,028,750 S879G possibly damaging Het
Asic1 A G 15: 99,699,125 D556G probably damaging Het
Atp2a3 T A 11: 72,978,807 probably null Het
Brinp2 C A 1: 158,246,558 E664D probably damaging Het
Cap2 C A 13: 46,615,323 H147N probably damaging Het
Cd209f G A 8: 4,104,862 Q79* probably null Het
Chrna7 T C 7: 63,212,142 Y54C possibly damaging Het
Clec1a T C 6: 129,437,004 D40G probably benign Het
Col11a1 A G 3: 114,061,535 E148G unknown Het
Comp A T 8: 70,378,957 probably null Het
Cpz A G 5: 35,508,116 probably null Het
Cyp2c50 A T 19: 40,091,055 M198L probably benign Het
Deup1 A T 9: 15,575,191 Y398N possibly damaging Het
Epb41l4a A G 18: 33,921,909 L42P probably damaging Het
Exo1 T C 1: 175,908,486 I812T possibly damaging Het
Fbxl17 A T 17: 63,385,065 probably null Het
Fxn A G 19: 24,262,013 Y172H probably damaging Het
Gabra6 A G 11: 42,317,634 S124P probably damaging Het
Gje1 C A 10: 14,716,807 W77L possibly damaging Het
Glra1 A G 11: 55,574,399 S23P probably damaging Het
Gm6614 T A 6: 141,982,049 probably null Het
Gm6811 T C 17: 21,094,267 noncoding transcript Het
Greb1l T A 18: 10,501,080 probably null Het
Greb1l T C 18: 10,529,708 probably null Het
Grm6 A T 11: 50,859,884 I625F probably damaging Het
Guca1a A G 17: 47,400,242 F60L probably damaging Het
Hectd1 T A 12: 51,753,824 E2070D possibly damaging Het
Itga5 G A 15: 103,347,902 T910I probably benign Het
Kctd10 A G 5: 114,368,990 V142A probably benign Het
Kif1c C T 11: 70,728,397 L953F probably damaging Het
Lmtk3 A T 7: 45,794,164 D757V probably benign Het
Lpcat1 T C 13: 73,510,123 probably null Het
Lrrc30 A T 17: 67,632,205 C127S probably benign Het
Mc4r A G 18: 66,859,409 L211P probably damaging Het
Mettl7a3 A G 15: 100,335,218 I97V probably benign Het
Mgat5b T A 11: 116,983,648 N635K probably benign Het
Mms19 A T 19: 41,952,556 M443K possibly damaging Het
Mroh5 T C 15: 73,787,905 N359S probably benign Het
Nlrc4 G A 17: 74,445,906 T494M probably damaging Het
Ntf3 T C 6: 126,102,438 D35G possibly damaging Het
Olfr1002 A T 2: 85,647,813 C169* probably null Het
Osbpl5 T C 7: 143,709,039 H192R probably damaging Het
Parp4 A T 14: 56,624,163 K984N possibly damaging Het
Pdgfra G A 5: 75,189,020 G892D possibly damaging Het
Pik3c2g A T 6: 139,635,636 probably benign Het
Ppcdc T A 9: 57,414,715 M181L possibly damaging Het
Pramel7 G A 2: 87,492,403 P6S probably damaging Het
Prkcz G T 4: 155,289,751 F69L probably damaging Het
Prkd1 G A 12: 50,394,926 H277Y probably damaging Het
Ptgs2 A G 1: 150,101,270 Y44C probably damaging Het
Rbck1 T A 2: 152,316,899 S488C probably damaging Het
Rbl1 T C 2: 157,159,734 Y878C probably damaging Het
Rbm6 G A 9: 107,791,856 T619I probably benign Het
Rp1 A G 1: 4,349,863 I342T probably damaging Het
Rpn2 C T 2: 157,294,155 T161M possibly damaging Het
Rufy4 G A 1: 74,147,678 V542I probably benign Het
Sema5b C T 16: 35,658,482 P559S probably benign Het
Serpinb3d A G 1: 107,080,751 V128A probably benign Het
Slc35f3 T A 8: 126,389,221 S296T probably damaging Het
Smarca2 A G 19: 26,647,034 I365V possibly damaging Het
Spdya T A 17: 71,578,240 C230S probably damaging Het
Sv2b G A 7: 75,206,341 A67V probably benign Het
Tapbpl A G 6: 125,230,201 V175A probably benign Het
Ttn T C 2: 76,811,751 T13373A probably damaging Het
Tubb5 A T 17: 35,836,638 N52K probably benign Het
Tyr T A 7: 87,492,941 Y137F probably damaging Het
Unc45b T A 11: 82,917,739 I217N probably benign Het
Vmn1r202 A T 13: 22,501,370 D292E possibly damaging Het
Vmn1r22 A G 6: 57,900,719 M91T probably benign Het
Washc2 T A 6: 116,223,254 probably null Het
Zfp566 A T 7: 30,078,476 H93Q probably benign Het
Zfp740 A G 15: 102,208,318 D56G probably damaging Het
Zfp804b A C 5: 6,771,323 L580R possibly damaging Het
Zmiz2 T G 11: 6,396,836 S148R probably benign Het
Zmym6 T A 4: 127,122,859 I719N probably damaging Het
Zyx T A 6: 42,356,032 V372E possibly damaging Het
Other mutations in Cyfip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Cyfip1 APN 7 55904210 missense probably damaging 1.00
IGL01351:Cyfip1 APN 7 55898243 nonsense probably null
IGL01662:Cyfip1 APN 7 55896739 missense probably damaging 1.00
IGL02034:Cyfip1 APN 7 55898353 missense probably damaging 0.99
IGL02039:Cyfip1 APN 7 55875021 missense possibly damaging 0.90
IGL02063:Cyfip1 APN 7 55926348 missense probably damaging 1.00
IGL02429:Cyfip1 APN 7 55871982 splice site probably benign
IGL03256:Cyfip1 APN 7 55907434 missense possibly damaging 0.67
R0455:Cyfip1 UTSW 7 55892054 missense probably benign 0.18
R0546:Cyfip1 UTSW 7 55922816 nonsense probably null
R0671:Cyfip1 UTSW 7 55923962 splice site probably null
R0732:Cyfip1 UTSW 7 55886781 missense probably damaging 1.00
R0843:Cyfip1 UTSW 7 55922820 missense probably benign 0.24
R1789:Cyfip1 UTSW 7 55926395 missense probably damaging 1.00
R1817:Cyfip1 UTSW 7 55873448 missense possibly damaging 0.51
R1929:Cyfip1 UTSW 7 55899957 missense probably null 1.00
R2271:Cyfip1 UTSW 7 55899957 missense probably null 1.00
R2272:Cyfip1 UTSW 7 55899957 missense probably null 1.00
R2328:Cyfip1 UTSW 7 55894991 missense possibly damaging 0.87
R2518:Cyfip1 UTSW 7 55928284 missense probably damaging 1.00
R2963:Cyfip1 UTSW 7 55895035 missense probably damaging 0.99
R4271:Cyfip1 UTSW 7 55879101 missense probably benign 0.02
R4435:Cyfip1 UTSW 7 55900041 missense probably damaging 0.99
R4640:Cyfip1 UTSW 7 55913451 missense possibly damaging 0.92
R4676:Cyfip1 UTSW 7 55875013 missense probably damaging 0.99
R4887:Cyfip1 UTSW 7 55872068 missense probably damaging 1.00
R5085:Cyfip1 UTSW 7 55898335 missense probably benign 0.33
R5238:Cyfip1 UTSW 7 55892031 missense probably benign
R5244:Cyfip1 UTSW 7 55925199 missense probably damaging 1.00
R5288:Cyfip1 UTSW 7 55925135 missense possibly damaging 0.60
R5294:Cyfip1 UTSW 7 55873483 missense possibly damaging 0.88
R5552:Cyfip1 UTSW 7 55872107 missense possibly damaging 0.94
R5558:Cyfip1 UTSW 7 55892001 missense possibly damaging 0.71
R5667:Cyfip1 UTSW 7 55873730 missense probably benign 0.19
R5819:Cyfip1 UTSW 7 55879151 missense probably damaging 1.00
R5859:Cyfip1 UTSW 7 55925181 missense probably damaging 1.00
R5867:Cyfip1 UTSW 7 55926313 missense probably damaging 1.00
R5868:Cyfip1 UTSW 7 55926313 missense probably damaging 1.00
R5944:Cyfip1 UTSW 7 55872130 missense probably damaging 0.98
R6124:Cyfip1 UTSW 7 55897943 missense probably benign 0.12
R6131:Cyfip1 UTSW 7 55873480 missense possibly damaging 0.79
R6219:Cyfip1 UTSW 7 55908441 missense possibly damaging 0.52
R6243:Cyfip1 UTSW 7 55900529 missense probably damaging 1.00
R6669:Cyfip1 UTSW 7 55900061 missense probably damaging 0.99
R6869:Cyfip1 UTSW 7 55907365 missense possibly damaging 0.73
R7014:Cyfip1 UTSW 7 55919493 missense probably benign 0.34
R7224:Cyfip1 UTSW 7 55928189 frame shift probably null
R7225:Cyfip1 UTSW 7 55928189 frame shift probably null
R7305:Cyfip1 UTSW 7 55928189 frame shift probably null
R7336:Cyfip1 UTSW 7 55926400 missense possibly damaging 0.96
R7429:Cyfip1 UTSW 7 55900593 missense probably damaging 1.00
R7430:Cyfip1 UTSW 7 55900593 missense probably damaging 1.00
R7469:Cyfip1 UTSW 7 55877720 missense possibly damaging 0.91
R7568:Cyfip1 UTSW 7 55872249 splice site probably null
R7830:Cyfip1 UTSW 7 55873462 missense probably damaging 1.00
R7839:Cyfip1 UTSW 7 55886735 missense probably damaging 0.98
R7859:Cyfip1 UTSW 7 55900026 missense probably damaging 1.00
R7965:Cyfip1 UTSW 7 55896775 missense possibly damaging 0.78
R8176:Cyfip1 UTSW 7 55924427 missense probably benign 0.12
R8386:Cyfip1 UTSW 7 55877740 missense probably damaging 1.00
R8388:Cyfip1 UTSW 7 55872125 missense probably damaging 1.00
X0018:Cyfip1 UTSW 7 55900025 missense probably damaging 0.98
X0028:Cyfip1 UTSW 7 55907430 missense probably damaging 1.00
Z1088:Cyfip1 UTSW 7 55875052 missense probably damaging 0.99
Z1177:Cyfip1 UTSW 7 55898320 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CGTCTCCAGTGCCCTTGAAAGAAAG -3'
(R):5'- CCATGCTAGAGTGGACAGTTGCTTG -3'

Sequencing Primer
(F):5'- GGGAAGAGAAGCCCATGTGAC -3'
(R):5'- GTATCTTGCAATGCCAGTGAC -3'
Posted On2014-05-09