Incidental Mutation 'R1666:Zmiz2'
ID187207
Institutional Source Beutler Lab
Gene Symbol Zmiz2
Ensembl Gene ENSMUSG00000041164
Gene Namezinc finger, MIZ-type containing 2
SynonymsZimp7, D11Bwg0280e, 2410117E06Rik
MMRRC Submission 039702-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1666 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location6389074-6406158 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 6396836 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 148 (S148R)
Ref Sequence ENSEMBL: ENSMUSP00000099978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012612] [ENSMUST00000102914] [ENSMUST00000109785] [ENSMUST00000109786] [ENSMUST00000109787]
Predicted Effect probably benign
Transcript: ENSMUST00000012612
AA Change: S180R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000012612
Gene: ENSMUSG00000041164
AA Change: S180R

DomainStartEndE-ValueType
low complexity region 60 82 N/A INTRINSIC
low complexity region 121 134 N/A INTRINSIC
low complexity region 147 170 N/A INTRINSIC
low complexity region 203 227 N/A INTRINSIC
low complexity region 247 264 N/A INTRINSIC
low complexity region 273 284 N/A INTRINSIC
low complexity region 289 307 N/A INTRINSIC
low complexity region 366 385 N/A INTRINSIC
Pfam:zf-MIZ 596 645 1.7e-26 PFAM
low complexity region 721 736 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102914
AA Change: S148R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000099978
Gene: ENSMUSG00000041164
AA Change: S148R

DomainStartEndE-ValueType
low complexity region 89 102 N/A INTRINSIC
low complexity region 115 138 N/A INTRINSIC
low complexity region 171 195 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
low complexity region 241 252 N/A INTRINSIC
low complexity region 257 275 N/A INTRINSIC
low complexity region 334 353 N/A INTRINSIC
Pfam:zf-Nse 556 611 3.8e-8 PFAM
Pfam:zf-MIZ 564 613 5.4e-26 PFAM
low complexity region 689 704 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109785
AA Change: S180R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000105408
Gene: ENSMUSG00000041164
AA Change: S180R

DomainStartEndE-ValueType
low complexity region 60 82 N/A INTRINSIC
low complexity region 121 134 N/A INTRINSIC
low complexity region 147 170 N/A INTRINSIC
low complexity region 203 227 N/A INTRINSIC
low complexity region 247 264 N/A INTRINSIC
low complexity region 273 284 N/A INTRINSIC
low complexity region 289 307 N/A INTRINSIC
low complexity region 340 359 N/A INTRINSIC
Pfam:zf-Nse 562 617 3.8e-8 PFAM
Pfam:zf-MIZ 570 619 5.4e-26 PFAM
low complexity region 695 710 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109786
AA Change: S180R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000105409
Gene: ENSMUSG00000041164
AA Change: S180R

DomainStartEndE-ValueType
low complexity region 60 82 N/A INTRINSIC
low complexity region 121 134 N/A INTRINSIC
low complexity region 147 170 N/A INTRINSIC
low complexity region 203 227 N/A INTRINSIC
low complexity region 247 264 N/A INTRINSIC
low complexity region 273 284 N/A INTRINSIC
low complexity region 289 307 N/A INTRINSIC
low complexity region 366 385 N/A INTRINSIC
Pfam:zf-Nse 588 643 4e-8 PFAM
Pfam:zf-MIZ 596 645 5.6e-26 PFAM
low complexity region 721 736 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109787
AA Change: S180R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000105410
Gene: ENSMUSG00000041164
AA Change: S180R

DomainStartEndE-ValueType
low complexity region 60 82 N/A INTRINSIC
low complexity region 121 134 N/A INTRINSIC
low complexity region 147 170 N/A INTRINSIC
low complexity region 203 227 N/A INTRINSIC
low complexity region 247 264 N/A INTRINSIC
low complexity region 273 284 N/A INTRINSIC
low complexity region 289 307 N/A INTRINSIC
low complexity region 366 385 N/A INTRINSIC
Pfam:zf-Nse 588 643 4e-8 PFAM
Pfam:zf-MIZ 596 645 5.6e-26 PFAM
low complexity region 721 736 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124588
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184154
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ZMIZ2 and ZMIZ1 (MIM 607159) are members of a PIAS (see MIM 603566)-like family of proteins that interact with nuclear hormone receptors. ZMIZ2 interacts with androgen receptor (AR; MIM 313700) and enhances AR-mediated transcription (Huang et al., 2005 [PubMed 16051670]).[supplied by OMIM, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A G 3: 108,469,997 S434P probably benign Het
Acvrl1 G A 15: 101,137,577 R328H probably damaging Het
Afp T C 5: 90,505,068 S466P probably damaging Het
Arhgap45 A G 10: 80,028,750 S879G possibly damaging Het
Asic1 A G 15: 99,699,125 D556G probably damaging Het
Atp2a3 T A 11: 72,978,807 probably null Het
Brinp2 C A 1: 158,246,558 E664D probably damaging Het
Cap2 C A 13: 46,615,323 H147N probably damaging Het
Cd209f G A 8: 4,104,862 Q79* probably null Het
Chrna7 T C 7: 63,212,142 Y54C possibly damaging Het
Clec1a T C 6: 129,437,004 D40G probably benign Het
Col11a1 A G 3: 114,061,535 E148G unknown Het
Comp A T 8: 70,378,957 probably null Het
Cpz A G 5: 35,508,116 probably null Het
Cyfip1 T A 7: 55,871,898 N13K probably damaging Het
Cyp2c50 A T 19: 40,091,055 M198L probably benign Het
Deup1 A T 9: 15,575,191 Y398N possibly damaging Het
Epb41l4a A G 18: 33,921,909 L42P probably damaging Het
Exo1 T C 1: 175,908,486 I812T possibly damaging Het
Fbxl17 A T 17: 63,385,065 probably null Het
Fxn A G 19: 24,262,013 Y172H probably damaging Het
Gabra6 A G 11: 42,317,634 S124P probably damaging Het
Gje1 C A 10: 14,716,807 W77L possibly damaging Het
Glra1 A G 11: 55,574,399 S23P probably damaging Het
Gm6614 T A 6: 141,982,049 probably null Het
Gm6811 T C 17: 21,094,267 noncoding transcript Het
Greb1l T A 18: 10,501,080 probably null Het
Greb1l T C 18: 10,529,708 probably null Het
Grm6 A T 11: 50,859,884 I625F probably damaging Het
Guca1a A G 17: 47,400,242 F60L probably damaging Het
Hectd1 T A 12: 51,753,824 E2070D possibly damaging Het
Itga5 G A 15: 103,347,902 T910I probably benign Het
Kctd10 A G 5: 114,368,990 V142A probably benign Het
Kif1c C T 11: 70,728,397 L953F probably damaging Het
Lmtk3 A T 7: 45,794,164 D757V probably benign Het
Lpcat1 T C 13: 73,510,123 probably null Het
Lrrc30 A T 17: 67,632,205 C127S probably benign Het
Mc4r A G 18: 66,859,409 L211P probably damaging Het
Mettl7a3 A G 15: 100,335,218 I97V probably benign Het
Mgat5b T A 11: 116,983,648 N635K probably benign Het
Mms19 A T 19: 41,952,556 M443K possibly damaging Het
Mroh5 T C 15: 73,787,905 N359S probably benign Het
Nlrc4 G A 17: 74,445,906 T494M probably damaging Het
Ntf3 T C 6: 126,102,438 D35G possibly damaging Het
Olfr1002 A T 2: 85,647,813 C169* probably null Het
Osbpl5 T C 7: 143,709,039 H192R probably damaging Het
Parp4 A T 14: 56,624,163 K984N possibly damaging Het
Pdgfra G A 5: 75,189,020 G892D possibly damaging Het
Pik3c2g A T 6: 139,635,636 probably benign Het
Ppcdc T A 9: 57,414,715 M181L possibly damaging Het
Pramel7 G A 2: 87,492,403 P6S probably damaging Het
Prkcz G T 4: 155,289,751 F69L probably damaging Het
Prkd1 G A 12: 50,394,926 H277Y probably damaging Het
Ptgs2 A G 1: 150,101,270 Y44C probably damaging Het
Rbck1 T A 2: 152,316,899 S488C probably damaging Het
Rbl1 T C 2: 157,159,734 Y878C probably damaging Het
Rbm6 G A 9: 107,791,856 T619I probably benign Het
Rp1 A G 1: 4,349,863 I342T probably damaging Het
Rpn2 C T 2: 157,294,155 T161M possibly damaging Het
Rufy4 G A 1: 74,147,678 V542I probably benign Het
Sema5b C T 16: 35,658,482 P559S probably benign Het
Serpinb3d A G 1: 107,080,751 V128A probably benign Het
Slc35f3 T A 8: 126,389,221 S296T probably damaging Het
Smarca2 A G 19: 26,647,034 I365V possibly damaging Het
Spdya T A 17: 71,578,240 C230S probably damaging Het
Sv2b G A 7: 75,206,341 A67V probably benign Het
Tapbpl A G 6: 125,230,201 V175A probably benign Het
Ttn T C 2: 76,811,751 T13373A probably damaging Het
Tubb5 A T 17: 35,836,638 N52K probably benign Het
Tyr T A 7: 87,492,941 Y137F probably damaging Het
Unc45b T A 11: 82,917,739 I217N probably benign Het
Vmn1r202 A T 13: 22,501,370 D292E possibly damaging Het
Vmn1r22 A G 6: 57,900,719 M91T probably benign Het
Washc2 T A 6: 116,223,254 probably null Het
Zfp566 A T 7: 30,078,476 H93Q probably benign Het
Zfp740 A G 15: 102,208,318 D56G probably damaging Het
Zfp804b A C 5: 6,771,323 L580R possibly damaging Het
Zmym6 T A 4: 127,122,859 I719N probably damaging Het
Zyx T A 6: 42,356,032 V372E possibly damaging Het
Other mutations in Zmiz2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Zmiz2 APN 11 6402845 missense probably damaging 0.98
IGL01345:Zmiz2 APN 11 6405015 missense possibly damaging 0.96
IGL01382:Zmiz2 APN 11 6403781 splice site probably null
IGL02942:Zmiz2 APN 11 6399500 splice site probably benign
IGL03156:Zmiz2 APN 11 6399536 missense probably damaging 1.00
IGL03301:Zmiz2 APN 11 6401170 missense probably damaging 1.00
P0037:Zmiz2 UTSW 11 6403885 missense probably damaging 1.00
R0938:Zmiz2 UTSW 11 6397185 missense probably benign
R1692:Zmiz2 UTSW 11 6400795 missense probably damaging 1.00
R4877:Zmiz2 UTSW 11 6403251 missense probably damaging 1.00
R5375:Zmiz2 UTSW 11 6397519 nonsense probably null
R5646:Zmiz2 UTSW 11 6402837 missense probably damaging 1.00
R5783:Zmiz2 UTSW 11 6405081 missense probably damaging 1.00
R5875:Zmiz2 UTSW 11 6405072 missense probably damaging 1.00
R6276:Zmiz2 UTSW 11 6395604 unclassified probably null
R6962:Zmiz2 UTSW 11 6402455 missense probably damaging 1.00
R6974:Zmiz2 UTSW 11 6397566 nonsense probably null
R6983:Zmiz2 UTSW 11 6402413 missense probably damaging 1.00
R7271:Zmiz2 UTSW 11 6399593 missense probably damaging 1.00
Z1088:Zmiz2 UTSW 11 6399603 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTGCTGTGTGTCCCAGAGAAAG -3'
(R):5'- CTGTTAAAAGACTGCCCAGTCCCC -3'

Sequencing Primer
(F):5'- CTGTATCACCTACAGGTATGCAGG -3'
(R):5'- AGTCCCCATCTGAGAGGAG -3'
Posted On2014-05-09