Incidental Mutation 'R1666:Itga5'
ID187230
Institutional Source Beutler Lab
Gene Symbol Itga5
Ensembl Gene ENSMUSG00000000555
Gene Nameintegrin alpha 5 (fibronectin receptor alpha)
SynonymsFnra, Cd49e
MMRRC Submission 039702-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1666 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location103344286-103366763 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 103347902 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 910 (T910I)
Ref Sequence ENSEMBL: ENSMUSP00000023128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023128] [ENSMUST00000215331]
Predicted Effect probably benign
Transcript: ENSMUST00000023128
AA Change: T910I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023128
Gene: ENSMUSG00000000555
AA Change: T910I

DomainStartEndE-ValueType
low complexity region 17 40 N/A INTRINSIC
Int_alpha 59 118 2.27e-8 SMART
Int_alpha 271 321 9.6e-7 SMART
Int_alpha 325 387 1.03e-15 SMART
Int_alpha 391 447 4.17e-16 SMART
Int_alpha 455 511 1.49e-3 SMART
SCOP:d1m1xa2 651 789 3e-44 SMART
SCOP:d1m1xa3 792 992 1e-62 SMART
transmembrane domain 1003 1025 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183535
Predicted Effect probably benign
Transcript: ENSMUST00000215331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230775
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: The product of this gene belongs to the integrin alpha chain family. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This gene encodes the integrin alpha 5 chain, which is proteolytically processed to generate light and heavy chains that join with beta 1 to form a fibronectin receptor. In addition to adhesion, integrins are known to participate in cell-surface mediated signaling. Integrin alpha 5 and integrin alpha V chains are produced by distinct genes. Homozygous knockout mice for this gene exhibit embryonic lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in posterior trunk and yolk sac mesodermal structures, lack of epithelialization of somites, reduced numbers of Schwann cells, and lethality around embryonic day 10-11. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A G 3: 108,469,997 S434P probably benign Het
Acvrl1 G A 15: 101,137,577 R328H probably damaging Het
Afp T C 5: 90,505,068 S466P probably damaging Het
Arhgap45 A G 10: 80,028,750 S879G possibly damaging Het
Asic1 A G 15: 99,699,125 D556G probably damaging Het
Atp2a3 T A 11: 72,978,807 probably null Het
Brinp2 C A 1: 158,246,558 E664D probably damaging Het
Cap2 C A 13: 46,615,323 H147N probably damaging Het
Cd209f G A 8: 4,104,862 Q79* probably null Het
Chrna7 T C 7: 63,212,142 Y54C possibly damaging Het
Clec1a T C 6: 129,437,004 D40G probably benign Het
Col11a1 A G 3: 114,061,535 E148G unknown Het
Comp A T 8: 70,378,957 probably null Het
Cpz A G 5: 35,508,116 probably null Het
Cyfip1 T A 7: 55,871,898 N13K probably damaging Het
Cyp2c50 A T 19: 40,091,055 M198L probably benign Het
Deup1 A T 9: 15,575,191 Y398N possibly damaging Het
Epb41l4a A G 18: 33,921,909 L42P probably damaging Het
Exo1 T C 1: 175,908,486 I812T possibly damaging Het
Fbxl17 A T 17: 63,385,065 probably null Het
Fxn A G 19: 24,262,013 Y172H probably damaging Het
Gabra6 A G 11: 42,317,634 S124P probably damaging Het
Gje1 C A 10: 14,716,807 W77L possibly damaging Het
Glra1 A G 11: 55,574,399 S23P probably damaging Het
Gm6614 T A 6: 141,982,049 probably null Het
Gm6811 T C 17: 21,094,267 noncoding transcript Het
Greb1l T A 18: 10,501,080 probably null Het
Greb1l T C 18: 10,529,708 probably null Het
Grm6 A T 11: 50,859,884 I625F probably damaging Het
Guca1a A G 17: 47,400,242 F60L probably damaging Het
Hectd1 T A 12: 51,753,824 E2070D possibly damaging Het
Kctd10 A G 5: 114,368,990 V142A probably benign Het
Kif1c C T 11: 70,728,397 L953F probably damaging Het
Lmtk3 A T 7: 45,794,164 D757V probably benign Het
Lpcat1 T C 13: 73,510,123 probably null Het
Lrrc30 A T 17: 67,632,205 C127S probably benign Het
Mc4r A G 18: 66,859,409 L211P probably damaging Het
Mettl7a3 A G 15: 100,335,218 I97V probably benign Het
Mgat5b T A 11: 116,983,648 N635K probably benign Het
Mms19 A T 19: 41,952,556 M443K possibly damaging Het
Mroh5 T C 15: 73,787,905 N359S probably benign Het
Nlrc4 G A 17: 74,445,906 T494M probably damaging Het
Ntf3 T C 6: 126,102,438 D35G possibly damaging Het
Olfr1002 A T 2: 85,647,813 C169* probably null Het
Osbpl5 T C 7: 143,709,039 H192R probably damaging Het
Parp4 A T 14: 56,624,163 K984N possibly damaging Het
Pdgfra G A 5: 75,189,020 G892D possibly damaging Het
Pik3c2g A T 6: 139,635,636 probably benign Het
Ppcdc T A 9: 57,414,715 M181L possibly damaging Het
Pramel7 G A 2: 87,492,403 P6S probably damaging Het
Prkcz G T 4: 155,289,751 F69L probably damaging Het
Prkd1 G A 12: 50,394,926 H277Y probably damaging Het
Ptgs2 A G 1: 150,101,270 Y44C probably damaging Het
Rbck1 T A 2: 152,316,899 S488C probably damaging Het
Rbl1 T C 2: 157,159,734 Y878C probably damaging Het
Rbm6 G A 9: 107,791,856 T619I probably benign Het
Rp1 A G 1: 4,349,863 I342T probably damaging Het
Rpn2 C T 2: 157,294,155 T161M possibly damaging Het
Rufy4 G A 1: 74,147,678 V542I probably benign Het
Sema5b C T 16: 35,658,482 P559S probably benign Het
Serpinb3d A G 1: 107,080,751 V128A probably benign Het
Slc35f3 T A 8: 126,389,221 S296T probably damaging Het
Smarca2 A G 19: 26,647,034 I365V possibly damaging Het
Spdya T A 17: 71,578,240 C230S probably damaging Het
Sv2b G A 7: 75,206,341 A67V probably benign Het
Tapbpl A G 6: 125,230,201 V175A probably benign Het
Ttn T C 2: 76,811,751 T13373A probably damaging Het
Tubb5 A T 17: 35,836,638 N52K probably benign Het
Tyr T A 7: 87,492,941 Y137F probably damaging Het
Unc45b T A 11: 82,917,739 I217N probably benign Het
Vmn1r202 A T 13: 22,501,370 D292E possibly damaging Het
Vmn1r22 A G 6: 57,900,719 M91T probably benign Het
Washc2 T A 6: 116,223,254 probably null Het
Zfp566 A T 7: 30,078,476 H93Q probably benign Het
Zfp740 A G 15: 102,208,318 D56G probably damaging Het
Zfp804b A C 5: 6,771,323 L580R possibly damaging Het
Zmiz2 T G 11: 6,396,836 S148R probably benign Het
Zmym6 T A 4: 127,122,859 I719N probably damaging Het
Zyx T A 6: 42,356,032 V372E possibly damaging Het
Other mutations in Itga5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00914:Itga5 APN 15 103350372 critical splice donor site probably null
IGL01102:Itga5 APN 15 103346675 missense probably benign 0.13
IGL01474:Itga5 APN 15 103354270 nonsense probably null
IGL01768:Itga5 APN 15 103351570 missense probably benign 0.34
IGL01832:Itga5 APN 15 103355949 nonsense probably null
IGL02188:Itga5 APN 15 103347717 missense probably benign 0.30
IGL02701:Itga5 APN 15 103347766 missense probably damaging 0.98
IGL02838:Itga5 APN 15 103351609 missense probably damaging 1.00
IGL02955:Itga5 APN 15 103350834 missense possibly damaging 0.48
R0617:Itga5 UTSW 15 103356315 critical splice donor site probably null
R0845:Itga5 UTSW 15 103350769 missense probably benign 0.07
R1210:Itga5 UTSW 15 103357473 missense possibly damaging 0.76
R1522:Itga5 UTSW 15 103356782 nonsense probably null
R1576:Itga5 UTSW 15 103351617 missense probably damaging 0.96
R1808:Itga5 UTSW 15 103350399 missense probably damaging 1.00
R1836:Itga5 UTSW 15 103346014 missense probably damaging 1.00
R1964:Itga5 UTSW 15 103354314 missense probably damaging 1.00
R4290:Itga5 UTSW 15 103352257 critical splice donor site probably null
R4458:Itga5 UTSW 15 103350203 missense probably damaging 1.00
R4610:Itga5 UTSW 15 103350832 missense probably damaging 1.00
R4676:Itga5 UTSW 15 103357210 missense probably damaging 1.00
R4795:Itga5 UTSW 15 103347760 missense probably benign 0.05
R4796:Itga5 UTSW 15 103347760 missense probably benign 0.05
R4837:Itga5 UTSW 15 103354084 missense probably damaging 0.99
R4929:Itga5 UTSW 15 103353235 missense probably benign 0.42
R5896:Itga5 UTSW 15 103351087 missense probably benign
R5947:Itga5 UTSW 15 103356785 missense probably damaging 1.00
R5957:Itga5 UTSW 15 103351429 missense probably benign 0.05
R6153:Itga5 UTSW 15 103357453 missense probably damaging 1.00
R6353:Itga5 UTSW 15 103352523 missense probably damaging 0.98
R6657:Itga5 UTSW 15 103350795 missense probably damaging 1.00
R6698:Itga5 UTSW 15 103351381 missense probably benign 0.15
R6891:Itga5 UTSW 15 103357543 missense probably damaging 1.00
R6981:Itga5 UTSW 15 103350226 missense probably benign 0.00
R7574:Itga5 UTSW 15 103350449 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATGAAGCTCCCTTACCTGCAAG -3'
(R):5'- GCTCTGGAACATAGGTTCAGGCTG -3'

Sequencing Primer
(F):5'- TTGGCCCAGACTCGGAAATG -3'
(R):5'- ACATAGGTTCAGGCTGACTTAG -3'
Posted On2014-05-09