Incidental Mutation 'R1666:Guca1a'
ID187235
Institutional Source Beutler Lab
Gene Symbol Guca1a
Ensembl Gene ENSMUSG00000023982
Gene Nameguanylate cyclase activator 1a (retina)
SynonymsmGCAP1, Guca1
MMRRC Submission 039702-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R1666 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location47394560-47400584 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 47400242 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 60 (F60L)
Ref Sequence ENSEMBL: ENSMUSP00000060027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059348]
Predicted Effect probably damaging
Transcript: ENSMUST00000059348
AA Change: F60L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060027
Gene: ENSMUSG00000023982
AA Change: F60L

DomainStartEndE-ValueType
EFh 55 83 3.01e-5 SMART
EFh 91 119 2.44e-5 SMART
EFh 135 163 5.83e-3 SMART
low complexity region 166 177 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a calcium-binding photoreceptor protein. The encoded protein may be involved in modulation of guanylyl cyclase activity, and in turn, the mammalian cone phototransduction cascade. Disruption of this gene results in the retinal degeneration associated with cone dystrophy. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice heterozygous or homozygous for a knock-in allele exhibit photoreceptor degeneration and loss of cone and rod function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A G 3: 108,469,997 S434P probably benign Het
Acvrl1 G A 15: 101,137,577 R328H probably damaging Het
Afp T C 5: 90,505,068 S466P probably damaging Het
Arhgap45 A G 10: 80,028,750 S879G possibly damaging Het
Asic1 A G 15: 99,699,125 D556G probably damaging Het
Atp2a3 T A 11: 72,978,807 probably null Het
Brinp2 C A 1: 158,246,558 E664D probably damaging Het
Cap2 C A 13: 46,615,323 H147N probably damaging Het
Cd209f G A 8: 4,104,862 Q79* probably null Het
Chrna7 T C 7: 63,212,142 Y54C possibly damaging Het
Clec1a T C 6: 129,437,004 D40G probably benign Het
Col11a1 A G 3: 114,061,535 E148G unknown Het
Comp A T 8: 70,378,957 probably null Het
Cpz A G 5: 35,508,116 probably null Het
Cyfip1 T A 7: 55,871,898 N13K probably damaging Het
Cyp2c50 A T 19: 40,091,055 M198L probably benign Het
Deup1 A T 9: 15,575,191 Y398N possibly damaging Het
Epb41l4a A G 18: 33,921,909 L42P probably damaging Het
Exo1 T C 1: 175,908,486 I812T possibly damaging Het
Fbxl17 A T 17: 63,385,065 probably null Het
Fxn A G 19: 24,262,013 Y172H probably damaging Het
Gabra6 A G 11: 42,317,634 S124P probably damaging Het
Gje1 C A 10: 14,716,807 W77L possibly damaging Het
Glra1 A G 11: 55,574,399 S23P probably damaging Het
Gm6614 T A 6: 141,982,049 probably null Het
Gm6811 T C 17: 21,094,267 noncoding transcript Het
Greb1l T A 18: 10,501,080 probably null Het
Greb1l T C 18: 10,529,708 probably null Het
Grm6 A T 11: 50,859,884 I625F probably damaging Het
Hectd1 T A 12: 51,753,824 E2070D possibly damaging Het
Itga5 G A 15: 103,347,902 T910I probably benign Het
Kctd10 A G 5: 114,368,990 V142A probably benign Het
Kif1c C T 11: 70,728,397 L953F probably damaging Het
Lmtk3 A T 7: 45,794,164 D757V probably benign Het
Lpcat1 T C 13: 73,510,123 probably null Het
Lrrc30 A T 17: 67,632,205 C127S probably benign Het
Mc4r A G 18: 66,859,409 L211P probably damaging Het
Mettl7a3 A G 15: 100,335,218 I97V probably benign Het
Mgat5b T A 11: 116,983,648 N635K probably benign Het
Mms19 A T 19: 41,952,556 M443K possibly damaging Het
Mroh5 T C 15: 73,787,905 N359S probably benign Het
Nlrc4 G A 17: 74,445,906 T494M probably damaging Het
Ntf3 T C 6: 126,102,438 D35G possibly damaging Het
Olfr1002 A T 2: 85,647,813 C169* probably null Het
Osbpl5 T C 7: 143,709,039 H192R probably damaging Het
Parp4 A T 14: 56,624,163 K984N possibly damaging Het
Pdgfra G A 5: 75,189,020 G892D possibly damaging Het
Pik3c2g A T 6: 139,635,636 probably benign Het
Ppcdc T A 9: 57,414,715 M181L possibly damaging Het
Pramel7 G A 2: 87,492,403 P6S probably damaging Het
Prkcz G T 4: 155,289,751 F69L probably damaging Het
Prkd1 G A 12: 50,394,926 H277Y probably damaging Het
Ptgs2 A G 1: 150,101,270 Y44C probably damaging Het
Rbck1 T A 2: 152,316,899 S488C probably damaging Het
Rbl1 T C 2: 157,159,734 Y878C probably damaging Het
Rbm6 G A 9: 107,791,856 T619I probably benign Het
Rp1 A G 1: 4,349,863 I342T probably damaging Het
Rpn2 C T 2: 157,294,155 T161M possibly damaging Het
Rufy4 G A 1: 74,147,678 V542I probably benign Het
Sema5b C T 16: 35,658,482 P559S probably benign Het
Serpinb3d A G 1: 107,080,751 V128A probably benign Het
Slc35f3 T A 8: 126,389,221 S296T probably damaging Het
Smarca2 A G 19: 26,647,034 I365V possibly damaging Het
Spdya T A 17: 71,578,240 C230S probably damaging Het
Sv2b G A 7: 75,206,341 A67V probably benign Het
Tapbpl A G 6: 125,230,201 V175A probably benign Het
Ttn T C 2: 76,811,751 T13373A probably damaging Het
Tubb5 A T 17: 35,836,638 N52K probably benign Het
Tyr T A 7: 87,492,941 Y137F probably damaging Het
Unc45b T A 11: 82,917,739 I217N probably benign Het
Vmn1r202 A T 13: 22,501,370 D292E possibly damaging Het
Vmn1r22 A G 6: 57,900,719 M91T probably benign Het
Washc2 T A 6: 116,223,254 probably null Het
Zfp566 A T 7: 30,078,476 H93Q probably benign Het
Zfp740 A G 15: 102,208,318 D56G probably damaging Het
Zfp804b A C 5: 6,771,323 L580R possibly damaging Het
Zmiz2 T G 11: 6,396,836 S148R probably benign Het
Zmym6 T A 4: 127,122,859 I719N probably damaging Het
Zyx T A 6: 42,356,032 V372E possibly damaging Het
Other mutations in Guca1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Guca1a APN 17 47400384 missense probably damaging 0.99
IGL01684:Guca1a APN 17 47395143 missense probably null 0.83
IGL01969:Guca1a APN 17 47400343 missense probably damaging 0.99
IGL02441:Guca1a APN 17 47394653 unclassified probably benign
IGL03273:Guca1a APN 17 47395173 missense probably benign 0.00
R1216:Guca1a UTSW 17 47395712 unclassified probably benign
R4849:Guca1a UTSW 17 47394737 missense possibly damaging 0.82
R5433:Guca1a UTSW 17 47400370 missense probably damaging 0.99
R6996:Guca1a UTSW 17 47395177 missense probably benign 0.05
Z1088:Guca1a UTSW 17 47400410 missense probably benign
Z1176:Guca1a UTSW 17 47400410 missense probably benign
Z1177:Guca1a UTSW 17 47400410 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCTGAACGAGCAGCTATGGAATC -3'
(R):5'- TTTAGTCCGACTCACAGGGCTGTC -3'

Sequencing Primer
(F):5'- ccacgagttgaaaaacagcc -3'
(R):5'- AAGATCTACCTGTCCATCTAGGG -3'
Posted On2014-05-09