Mutagenetix > Incidental Mutation

Incidental Mutation 'R1666:Greb1l'

187241

Institutional Source

Beutler Lab

Gene Symbol

Greb1l

Ensembl Gene

ENSMUSG00000042942

Gene Name

growth regulation by estrogen in breast cancer-like

Synonyms

AK220484, mKIAA4095

MMRRC Submission

039702-MU

Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1666 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

10325177-10562934 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to A at 10501080 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000134090 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532]

AlphaFold

B9EJV3

Predicted Effect

probably null
Transcript: ENSMUST00000048977

SMART Domains

Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942

Domain	Start	End	E-Value	Type
Pfam:GREB1	1	1172	N/A	PFAM
Pfam:GREB1	1154	1913	N/A	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000172532

SMART Domains

Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942

Domain	Start	End	E-Value	Type
low complexity region	83	100	N/A	INTRINSIC
low complexity region	282	301	N/A	INTRINSIC
low complexity region	606	617	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173356

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224958

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.6%

Validation Efficiency

Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417C22Rik	A	G	3: 108,469,997	S434P	probably benign	Het
Acvrl1	G	A	15: 101,137,577	R328H	probably damaging	Het
Afp	T	C	5: 90,505,068	S466P	probably damaging	Het
Arhgap45	A	G	10: 80,028,750	S879G	possibly damaging	Het
Asic1	A	G	15: 99,699,125	D556G	probably damaging	Het
Atp2a3	T	A	11: 72,978,807		probably null	Het
Brinp2	C	A	1: 158,246,558	E664D	probably damaging	Het
Cap2	C	A	13: 46,615,323	H147N	probably damaging	Het
Cd209f	G	A	8: 4,104,862	Q79*	probably null	Het
Chrna7	T	C	7: 63,212,142	Y54C	possibly damaging	Het
Clec1a	T	C	6: 129,437,004	D40G	probably benign	Het
Col11a1	A	G	3: 114,061,535	E148G	unknown	Het
Comp	A	T	8: 70,378,957		probably null	Het
Cpz	A	G	5: 35,508,116		probably null	Het
Cyfip1	T	A	7: 55,871,898	N13K	probably damaging	Het
Cyp2c50	A	T	19: 40,091,055	M198L	probably benign	Het
Deup1	A	T	9: 15,575,191	Y398N	possibly damaging	Het
Epb41l4a	A	G	18: 33,921,909	L42P	probably damaging	Het
Exo1	T	C	1: 175,908,486	I812T	possibly damaging	Het
Fbxl17	A	T	17: 63,385,065		probably null	Het
Fxn	A	G	19: 24,262,013	Y172H	probably damaging	Het
Gabra6	A	G	11: 42,317,634	S124P	probably damaging	Het
Gje1	C	A	10: 14,716,807	W77L	possibly damaging	Het
Glra1	A	G	11: 55,574,399	S23P	probably damaging	Het
Gm6614	T	A	6: 141,982,049		probably null	Het
Gm6811	T	C	17: 21,094,267		noncoding transcript	Het
Grm6	A	T	11: 50,859,884	I625F	probably damaging	Het
Guca1a	A	G	17: 47,400,242	F60L	probably damaging	Het
Hectd1	T	A	12: 51,753,824	E2070D	possibly damaging	Het
Itga5	G	A	15: 103,347,902	T910I	probably benign	Het
Kctd10	A	G	5: 114,368,990	V142A	probably benign	Het
Kif1c	C	T	11: 70,728,397	L953F	probably damaging	Het
Lmtk3	A	T	7: 45,794,164	D757V	probably benign	Het
Lpcat1	T	C	13: 73,510,123		probably null	Het
Lrrc30	A	T	17: 67,632,205	C127S	probably benign	Het
Mc4r	A	G	18: 66,859,409	L211P	probably damaging	Het
Mettl7a3	A	G	15: 100,335,218	I97V	probably benign	Het
Mgat5b	T	A	11: 116,983,648	N635K	probably benign	Het
Mms19	A	T	19: 41,952,556	M443K	possibly damaging	Het
Mroh5	T	C	15: 73,787,905	N359S	probably benign	Het
Nlrc4	G	A	17: 74,445,906	T494M	probably damaging	Het
Ntf3	T	C	6: 126,102,438	D35G	possibly damaging	Het
Olfr1002	A	T	2: 85,647,813	C169*	probably null	Het
Osbpl5	T	C	7: 143,709,039	H192R	probably damaging	Het
Parp4	A	T	14: 56,624,163	K984N	possibly damaging	Het
Pdgfra	G	A	5: 75,189,020	G892D	possibly damaging	Het
Pik3c2g	A	T	6: 139,635,636		probably benign	Het
Ppcdc	T	A	9: 57,414,715	M181L	possibly damaging	Het
Pramel7	G	A	2: 87,492,403	P6S	probably damaging	Het
Prkcz	G	T	4: 155,289,751	F69L	probably damaging	Het
Prkd1	G	A	12: 50,394,926	H277Y	probably damaging	Het
Ptgs2	A	G	1: 150,101,270	Y44C	probably damaging	Het
Rbck1	T	A	2: 152,316,899	S488C	probably damaging	Het
Rbl1	T	C	2: 157,159,734	Y878C	probably damaging	Het
Rbm6	G	A	9: 107,791,856	T619I	probably benign	Het
Rp1	A	G	1: 4,349,863	I342T	probably damaging	Het
Rpn2	C	T	2: 157,294,155	T161M	possibly damaging	Het
Rufy4	G	A	1: 74,147,678	V542I	probably benign	Het
Sema5b	C	T	16: 35,658,482	P559S	probably benign	Het
Serpinb3d	A	G	1: 107,080,751	V128A	probably benign	Het
Slc35f3	T	A	8: 126,389,221	S296T	probably damaging	Het
Smarca2	A	G	19: 26,647,034	I365V	possibly damaging	Het
Spdya	T	A	17: 71,578,240	C230S	probably damaging	Het
Sv2b	G	A	7: 75,206,341	A67V	probably benign	Het
Tapbpl	A	G	6: 125,230,201	V175A	probably benign	Het
Ttn	T	C	2: 76,811,751	T13373A	probably damaging	Het
Tubb5	A	T	17: 35,836,638	N52K	probably benign	Het
Tyr	T	A	7: 87,492,941	Y137F	probably damaging	Het
Unc45b	T	A	11: 82,917,739	I217N	probably benign	Het
Vmn1r202	A	T	13: 22,501,370	D292E	possibly damaging	Het
Vmn1r22	A	G	6: 57,900,719	M91T	probably benign	Het
Washc2	T	A	6: 116,223,254		probably null	Het
Zfp566	A	T	7: 30,078,476	H93Q	probably benign	Het
Zfp740	A	G	15: 102,208,318	D56G	probably damaging	Het
Zfp804b	A	C	5: 6,771,323	L580R	possibly damaging	Het
Zmiz2	T	G	11: 6,396,836	S148R	probably benign	Het
Zmym6	T	A	4: 127,122,859	I719N	probably damaging	Het
Zyx	T	A	6: 42,356,032	V372E	possibly damaging	Het

Other mutations in Greb1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Greb1l	APN	18	10555962	missense	possibly damaging	0.90
IGL01554:Greb1l	APN	18	10522144	missense	probably benign	0.01
IGL01563:Greb1l	APN	18	10469399	missense	probably damaging	0.99
IGL01944:Greb1l	APN	18	10557280	missense	possibly damaging	0.91
IGL02110:Greb1l	APN	18	10515271	missense	probably damaging	1.00
IGL02249:Greb1l	APN	18	10532961	missense	probably damaging	1.00
IGL02318:Greb1l	APN	18	10469388	missense	possibly damaging	0.91
IGL02340:Greb1l	APN	18	10515200	missense	probably damaging	0.99
IGL02516:Greb1l	APN	18	10537064	missense	probably benign	0.31
IGL02566:Greb1l	APN	18	10503299	missense	probably damaging	0.99
IGL02583:Greb1l	APN	18	10542362	missense	probably damaging	1.00
IGL02838:Greb1l	APN	18	10560430	missense	probably damaging	1.00
A4554:Greb1l	UTSW	18	10532862	missense	possibly damaging	0.58
PIT4453001:Greb1l	UTSW	18	10533031	missense	probably damaging	0.98
PIT4453001:Greb1l	UTSW	18	10533032	missense	probably benign	0.08
R0099:Greb1l	UTSW	18	10509158	missense	probably damaging	1.00
R0226:Greb1l	UTSW	18	10522076	intron	probably benign
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0239:Greb1l	UTSW	18	10458567	splice site	probably benign
R0316:Greb1l	UTSW	18	10547420	missense	probably damaging	1.00
R0369:Greb1l	UTSW	18	10469375	missense	possibly damaging	0.80
R0394:Greb1l	UTSW	18	10523374	missense	probably damaging	0.99
R0478:Greb1l	UTSW	18	10509281	missense	probably damaging	1.00
R0555:Greb1l	UTSW	18	10458781	splice site	probably benign
R0671:Greb1l	UTSW	18	10474303	missense	probably damaging	1.00
R1282:Greb1l	UTSW	18	10547289	missense	probably benign	0.13
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1607:Greb1l	UTSW	18	10529703	missense	possibly damaging	0.85
R1666:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R1720:Greb1l	UTSW	18	10553848	missense	probably benign	0.19
R1808:Greb1l	UTSW	18	10542143	missense	probably benign
R1829:Greb1l	UTSW	18	10509314	missense	probably damaging	1.00
R1897:Greb1l	UTSW	18	10498992	missense	probably benign	0.00
R1967:Greb1l	UTSW	18	10501049	missense	possibly damaging	0.91
R2025:Greb1l	UTSW	18	10515221	missense	possibly damaging	0.71
R2086:Greb1l	UTSW	18	10523281	missense	probably damaging	1.00
R2125:Greb1l	UTSW	18	10511422	missense	probably damaging	0.98
R2139:Greb1l	UTSW	18	10555011	missense	probably damaging	1.00
R2255:Greb1l	UTSW	18	10554857	missense	probably damaging	1.00
R2256:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2257:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2880:Greb1l	UTSW	18	10547288	missense	possibly damaging	0.93
R3623:Greb1l	UTSW	18	10542380	missense	probably damaging	0.99
R3778:Greb1l	UTSW	18	10469444	missense	possibly damaging	0.60
R3975:Greb1l	UTSW	18	10522247	missense	possibly damaging	0.71
R4038:Greb1l	UTSW	18	10515209	missense	possibly damaging	0.93
R4062:Greb1l	UTSW	18	10522150	missense	probably damaging	0.99
R4134:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R4342:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R4409:Greb1l	UTSW	18	10503182	missense	possibly damaging	0.70
R4600:Greb1l	UTSW	18	10553705	missense	probably damaging	1.00
R4618:Greb1l	UTSW	18	10498965	missense	probably benign	0.00
R4683:Greb1l	UTSW	18	10529563	splice site	probably null
R4686:Greb1l	UTSW	18	10522112	missense	probably damaging	0.98
R4707:Greb1l	UTSW	18	10532922	missense	probably benign	0.02
R4780:Greb1l	UTSW	18	10541792	missense	probably benign	0.00
R4819:Greb1l	UTSW	18	10458358	missense	probably damaging	1.00
R4925:Greb1l	UTSW	18	10547447	missense	possibly damaging	0.79
R4960:Greb1l	UTSW	18	10547306	missense	probably damaging	0.99
R5150:Greb1l	UTSW	18	10555950	frame shift	probably null
R5154:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5269:Greb1l	UTSW	18	10511409	missense	probably benign
R5290:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5310:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5328:Greb1l	UTSW	18	10553720	missense	probably damaging	1.00
R5337:Greb1l	UTSW	18	10509143	missense	probably damaging	1.00
R5393:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5402:Greb1l	UTSW	18	10537169	missense	probably benign	0.26
R5718:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5719:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5720:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5721:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5902:Greb1l	UTSW	18	10538302	missense	probably benign	0.00
R5993:Greb1l	UTSW	18	10544455	missense	probably benign	0.10
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6045:Greb1l	UTSW	18	10547068	missense	probably damaging	1.00
R6063:Greb1l	UTSW	18	10557340	missense	probably damaging	1.00
R6297:Greb1l	UTSW	18	10469494	missense	probably damaging	1.00
R6405:Greb1l	UTSW	18	10501076	missense	probably benign	0.30
R6552:Greb1l	UTSW	18	10541814	missense	probably benign	0.00
R6572:Greb1l	UTSW	18	10522131	missense	probably benign	0.07
R6575:Greb1l	UTSW	18	10547347	missense	possibly damaging	0.88
R6922:Greb1l	UTSW	18	10547482	missense	possibly damaging	0.88
R6957:Greb1l	UTSW	18	10558786	missense	probably benign	0.23
R6962:Greb1l	UTSW	18	10547327	missense	probably damaging	1.00
R7012:Greb1l	UTSW	18	10529707	critical splice donor site	probably null
R7179:Greb1l	UTSW	18	10544576	missense	probably benign	0.00
R7251:Greb1l	UTSW	18	10515319	missense	probably damaging	1.00
R7275:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R7301:Greb1l	UTSW	18	10544970	missense	probably damaging	1.00
R7307:Greb1l	UTSW	18	10538142	missense	probably damaging	0.99
R7455:Greb1l	UTSW	18	10554915	missense	probably damaging	1.00
R7832:Greb1l	UTSW	18	10542056	missense	probably benign	0.38
R7934:Greb1l	UTSW	18	10474371	nonsense	probably null
R8137:Greb1l	UTSW	18	10474357	missense	possibly damaging	0.77
R8138:Greb1l	UTSW	18	10533060	missense	probably benign	0.13
R8208:Greb1l	UTSW	18	10510703	missense	probably damaging	1.00
R8227:Greb1l	UTSW	18	10515371	missense	probably damaging	1.00
R8312:Greb1l	UTSW	18	10511587	intron	probably benign
R8331:Greb1l	UTSW	18	10458706	missense	possibly damaging	0.96
R8364:Greb1l	UTSW	18	10529687	missense	possibly damaging	0.85
R8389:Greb1l	UTSW	18	10529613	missense	probably benign	0.00
R8695:Greb1l	UTSW	18	10544450	missense	probably benign	0.01
R8795:Greb1l	UTSW	18	10553739	missense	probably damaging	0.98
R8836:Greb1l	UTSW	18	10509257	missense	probably benign	0.30
R8862:Greb1l	UTSW	18	10555042	missense	possibly damaging	0.90
R8872:Greb1l	UTSW	18	10529684	missense	probably benign	0.18
R8874:Greb1l	UTSW	18	10544896	missense	probably benign	0.01
R8886:Greb1l	UTSW	18	10553843	missense	probably benign	0.21
R8921:Greb1l	UTSW	18	10541825	missense	probably benign	0.01
R8997:Greb1l	UTSW	18	10510747	missense	probably damaging	1.00
R9015:Greb1l	UTSW	18	10541675	missense	probably benign	0.00
R9018:Greb1l	UTSW	18	10542004	missense	possibly damaging	0.76
R9074:Greb1l	UTSW	18	10532797	missense	probably damaging	1.00
R9074:Greb1l	UTSW	18	10558795	missense	probably damaging	1.00
R9117:Greb1l	UTSW	18	10542422	missense	probably benign	0.31
R9189:Greb1l	UTSW	18	10499983	missense	probably benign
R9332:Greb1l	UTSW	18	10532796	missense	possibly damaging	0.92
R9367:Greb1l	UTSW	18	10522130	missense	probably benign	0.00
R9497:Greb1l	UTSW	18	10458600	missense	probably benign	0.00
R9796:Greb1l	UTSW	18	10538233	missense	possibly damaging	0.69
Z1176:Greb1l	UTSW	18	10515305	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAAGTAGACAGTGACAAGTGCTCCAA -3'
(R):5'- TTGAGGGCAAATGCCTTATTCTCAACT -3'

Sequencing Primer
(F):5'- aaatctaccaaaatgctcagtagtc -3'
(R):5'- GGGCTAGCCAAAGAAAACTG -3'

Posted On

2014-05-09