Incidental Mutation 'R1666:Mms19'
Institutional Source Beutler Lab
Gene Symbol Mms19
Ensembl Gene ENSMUSG00000025159
Gene NameMMS19 (MET18 S. cerevisiae)
SynonymsMms19, 2610042O15Rik, C86341, Mms19l
MMRRC Submission 039702-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R1666 (G1)
Quality Score225
Status Not validated
Chromosomal Location41941086-41981157 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 41952556 bp
Amino Acid Change Methionine to Lysine at position 443 (M443K)
Ref Sequence ENSEMBL: ENSMUSP00000128653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026168] [ENSMUST00000163287] [ENSMUST00000163398] [ENSMUST00000164776] [ENSMUST00000167820] [ENSMUST00000167927] [ENSMUST00000168484] [ENSMUST00000169775] [ENSMUST00000171561]
Predicted Effect probably benign
Transcript: ENSMUST00000026168
AA Change: M546K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026168
Gene: ENSMUSG00000025159
AA Change: M546K

Pfam:MMS19_N 51 167 1.4e-29 PFAM
Pfam:MMS19_N 163 270 2.4e-44 PFAM
low complexity region 329 343 N/A INTRINSIC
Pfam:MMS19_C 484 921 4.3e-120 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000163287
AA Change: M443K

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000128653
Gene: ENSMUSG00000025159
AA Change: M443K

Pfam:MMS19_N 3 265 9.8e-97 PFAM
Pfam:MMS19_C 381 818 1e-120 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163398
Predicted Effect probably benign
Transcript: ENSMUST00000164776
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165043
Predicted Effect unknown
Transcript: ENSMUST00000166090
AA Change: M162K
SMART Domains Protein: ENSMUSP00000131219
Gene: ENSMUSG00000025159
AA Change: M162K

Pfam:MMS19_C 102 494 2.2e-97 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166517
Predicted Effect probably benign
Transcript: ENSMUST00000167820
SMART Domains Protein: ENSMUSP00000130399
Gene: ENSMUSG00000025159

Pfam:MMS19_C 63 286 7.9e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167927
SMART Domains Protein: ENSMUSP00000132483
Gene: ENSMUSG00000025159

Pfam:MMS19_N 51 313 4.6e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168484
SMART Domains Protein: ENSMUSP00000126881
Gene: ENSMUSG00000025159

Pfam:MMS19_N 51 313 4.6e-99 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168737
Predicted Effect probably benign
Transcript: ENSMUST00000169775
SMART Domains Protein: ENSMUSP00000128234
Gene: ENSMUSG00000025159

Pfam:MMS19_N 51 167 1.5e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171561
AA Change: M589K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000130900
Gene: ENSMUSG00000025159
AA Change: M589K

Pfam:MMS19_N 51 312 6.3e-90 PFAM
low complexity region 372 386 N/A INTRINSIC
Pfam:MMS19_C 528 963 3.9e-116 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170209
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A G 3: 108,469,997 S434P probably benign Het
Acvrl1 G A 15: 101,137,577 R328H probably damaging Het
Afp T C 5: 90,505,068 S466P probably damaging Het
Arhgap45 A G 10: 80,028,750 S879G possibly damaging Het
Asic1 A G 15: 99,699,125 D556G probably damaging Het
Atp2a3 T A 11: 72,978,807 probably null Het
Brinp2 C A 1: 158,246,558 E664D probably damaging Het
Cap2 C A 13: 46,615,323 H147N probably damaging Het
Cd209f G A 8: 4,104,862 Q79* probably null Het
Chrna7 T C 7: 63,212,142 Y54C possibly damaging Het
Clec1a T C 6: 129,437,004 D40G probably benign Het
Col11a1 A G 3: 114,061,535 E148G unknown Het
Comp A T 8: 70,378,957 probably null Het
Cpz A G 5: 35,508,116 probably null Het
Cyfip1 T A 7: 55,871,898 N13K probably damaging Het
Cyp2c50 A T 19: 40,091,055 M198L probably benign Het
Deup1 A T 9: 15,575,191 Y398N possibly damaging Het
Epb41l4a A G 18: 33,921,909 L42P probably damaging Het
Exo1 T C 1: 175,908,486 I812T possibly damaging Het
Fbxl17 A T 17: 63,385,065 probably null Het
Fxn A G 19: 24,262,013 Y172H probably damaging Het
Gabra6 A G 11: 42,317,634 S124P probably damaging Het
Gje1 C A 10: 14,716,807 W77L possibly damaging Het
Glra1 A G 11: 55,574,399 S23P probably damaging Het
Gm6614 T A 6: 141,982,049 probably null Het
Gm6811 T C 17: 21,094,267 noncoding transcript Het
Greb1l T A 18: 10,501,080 probably null Het
Greb1l T C 18: 10,529,708 probably null Het
Grm6 A T 11: 50,859,884 I625F probably damaging Het
Guca1a A G 17: 47,400,242 F60L probably damaging Het
Hectd1 T A 12: 51,753,824 E2070D possibly damaging Het
Itga5 G A 15: 103,347,902 T910I probably benign Het
Kctd10 A G 5: 114,368,990 V142A probably benign Het
Kif1c C T 11: 70,728,397 L953F probably damaging Het
Lmtk3 A T 7: 45,794,164 D757V probably benign Het
Lpcat1 T C 13: 73,510,123 probably null Het
Lrrc30 A T 17: 67,632,205 C127S probably benign Het
Mc4r A G 18: 66,859,409 L211P probably damaging Het
Mettl7a3 A G 15: 100,335,218 I97V probably benign Het
Mgat5b T A 11: 116,983,648 N635K probably benign Het
Mroh5 T C 15: 73,787,905 N359S probably benign Het
Nlrc4 G A 17: 74,445,906 T494M probably damaging Het
Ntf3 T C 6: 126,102,438 D35G possibly damaging Het
Olfr1002 A T 2: 85,647,813 C169* probably null Het
Osbpl5 T C 7: 143,709,039 H192R probably damaging Het
Parp4 A T 14: 56,624,163 K984N possibly damaging Het
Pdgfra G A 5: 75,189,020 G892D possibly damaging Het
Pik3c2g A T 6: 139,635,636 probably benign Het
Ppcdc T A 9: 57,414,715 M181L possibly damaging Het
Pramel7 G A 2: 87,492,403 P6S probably damaging Het
Prkcz G T 4: 155,289,751 F69L probably damaging Het
Prkd1 G A 12: 50,394,926 H277Y probably damaging Het
Ptgs2 A G 1: 150,101,270 Y44C probably damaging Het
Rbck1 T A 2: 152,316,899 S488C probably damaging Het
Rbl1 T C 2: 157,159,734 Y878C probably damaging Het
Rbm6 G A 9: 107,791,856 T619I probably benign Het
Rp1 A G 1: 4,349,863 I342T probably damaging Het
Rpn2 C T 2: 157,294,155 T161M possibly damaging Het
Rufy4 G A 1: 74,147,678 V542I probably benign Het
Sema5b C T 16: 35,658,482 P559S probably benign Het
Serpinb3d A G 1: 107,080,751 V128A probably benign Het
Slc35f3 T A 8: 126,389,221 S296T probably damaging Het
Smarca2 A G 19: 26,647,034 I365V possibly damaging Het
Spdya T A 17: 71,578,240 C230S probably damaging Het
Sv2b G A 7: 75,206,341 A67V probably benign Het
Tapbpl A G 6: 125,230,201 V175A probably benign Het
Ttn T C 2: 76,811,751 T13373A probably damaging Het
Tubb5 A T 17: 35,836,638 N52K probably benign Het
Tyr T A 7: 87,492,941 Y137F probably damaging Het
Unc45b T A 11: 82,917,739 I217N probably benign Het
Vmn1r202 A T 13: 22,501,370 D292E possibly damaging Het
Vmn1r22 A G 6: 57,900,719 M91T probably benign Het
Washc2 T A 6: 116,223,254 probably null Het
Zfp566 A T 7: 30,078,476 H93Q probably benign Het
Zfp740 A G 15: 102,208,318 D56G probably damaging Het
Zfp804b A C 5: 6,771,323 L580R possibly damaging Het
Zmiz2 T G 11: 6,396,836 S148R probably benign Het
Zmym6 T A 4: 127,122,859 I719N probably damaging Het
Zyx T A 6: 42,356,032 V372E possibly damaging Het
Other mutations in Mms19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Mms19 APN 19 41948233 missense probably benign 0.12
IGL00157:Mms19 APN 19 41945457 critical splice donor site probably null
IGL01997:Mms19 APN 19 41956531 missense probably damaging 1.00
IGL02081:Mms19 APN 19 41949979 critical splice donor site probably null
IGL02171:Mms19 APN 19 41957139 critical splice donor site probably null
IGL02306:Mms19 APN 19 41966264 missense probably damaging 1.00
IGL02678:Mms19 APN 19 41954476 missense possibly damaging 0.84
IGL02795:Mms19 APN 19 41952406 critical splice donor site probably null
IGL03233:Mms19 APN 19 41946913 splice site probably null
IGL03250:Mms19 APN 19 41954464 critical splice donor site probably null
R0049:Mms19 UTSW 19 41955168 missense probably damaging 0.99
R0049:Mms19 UTSW 19 41955168 missense probably damaging 0.99
R0480:Mms19 UTSW 19 41954846 missense probably damaging 0.98
R0498:Mms19 UTSW 19 41949773 missense possibly damaging 0.82
R0505:Mms19 UTSW 19 41953734 missense probably damaging 1.00
R0547:Mms19 UTSW 19 41963418 missense probably damaging 0.99
R1102:Mms19 UTSW 19 41950845 missense possibly damaging 0.77
R1183:Mms19 UTSW 19 41954831 missense possibly damaging 0.83
R1544:Mms19 UTSW 19 41955821 critical splice donor site probably null
R1668:Mms19 UTSW 19 41952556 missense possibly damaging 0.73
R1808:Mms19 UTSW 19 41966259 missense probably damaging 1.00
R1827:Mms19 UTSW 19 41953677 missense probably benign 0.00
R3055:Mms19 UTSW 19 41950088 splice site probably benign
R3551:Mms19 UTSW 19 41949798 missense probably benign 0.04
R3716:Mms19 UTSW 19 41944735 missense probably damaging 1.00
R3877:Mms19 UTSW 19 41966256 nonsense probably null
R4288:Mms19 UTSW 19 41945553 missense probably damaging 1.00
R4289:Mms19 UTSW 19 41945553 missense probably damaging 1.00
R4445:Mms19 UTSW 19 41963933 missense possibly damaging 0.48
R4446:Mms19 UTSW 19 41963933 missense possibly damaging 0.48
R4610:Mms19 UTSW 19 41945496 missense possibly damaging 0.91
R4734:Mms19 UTSW 19 41944558 missense probably damaging 1.00
R4748:Mms19 UTSW 19 41944558 missense probably damaging 1.00
R5315:Mms19 UTSW 19 41954762 missense possibly damaging 0.68
R5492:Mms19 UTSW 19 41955831 missense possibly damaging 0.91
R5621:Mms19 UTSW 19 41966313 missense probably benign 0.27
R5643:Mms19 UTSW 19 41955866 missense possibly damaging 0.87
R5769:Mms19 UTSW 19 41964386 missense probably damaging 1.00
R6567:Mms19 UTSW 19 41949767 critical splice donor site probably null
R6569:Mms19 UTSW 19 41964368 missense possibly damaging 0.93
R6588:Mms19 UTSW 19 41966276 missense probably damaging 1.00
R6645:Mms19 UTSW 19 41955191 missense probably benign 0.04
R6696:Mms19 UTSW 19 41954013 missense probably benign 0.41
R7050:Mms19 UTSW 19 41950746 splice site probably null
R7426:Mms19 UTSW 19 41948278 missense probably benign
R7564:Mms19 UTSW 19 41947016 missense probably benign 0.09
R7655:Mms19 UTSW 19 41944572 missense probably damaging 0.98
R7656:Mms19 UTSW 19 41944572 missense probably damaging 0.98
R7687:Mms19 UTSW 19 41955168 missense possibly damaging 0.85
R7729:Mms19 UTSW 19 41952465 nonsense probably null
R7942:Mms19 UTSW 19 41955961 missense probably damaging 1.00
R8464:Mms19 UTSW 19 41947083 missense probably damaging 1.00
R8681:Mms19 UTSW 19 41949476 missense probably damaging 1.00
Z1177:Mms19 UTSW 19 41957140 critical splice donor site probably null
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- cagatgtggagataggtaggaag -3'
Posted On2014-05-09