Mutagenetix > Incidental Mutations

Incidental Mutation 'R1667:Prex2'

187249

Institutional Source

Beutler Lab

Gene Symbol

Prex2

Ensembl Gene

ENSMUSG00000048960

Gene Name

phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2

Synonyms

C030045D06Rik, 6230420N16Rik, Depdc2

MMRRC Submission

039703-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.136) question?

Stock #

R1667 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

10993465-11303681 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 11186757 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 1231 (H1231L)

Ref Sequence

ENSEMBL: ENSMUSP00000027056 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027056]

Predicted Effect

probably benign
Transcript: ENSMUST00000027056
AA Change: H1231L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000027056
Gene: ENSMUSG00000048960
AA Change: H1231L

Domain	Start	End	E-Value	Type
RhoGEF	19	205	8.61e-45	SMART
PH	238	355	2.43e-12	SMART
DEP	383	456	4.46e-26	SMART
DEP	484	557	6.57e-15	SMART
PDZ	593	666	9.62e-2	SMART
PDZ	677	744	6.37e-8	SMART
low complexity region	1112	1127	N/A	INTRINSIC
low complexity region	1498	1507	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.0%

Validation Efficiency

99% (76/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphatidylinositol 3,4,5-trisphosphate (PIP3)-dependent Rac exchanger (PREX) family, which are Dbl-type guanine-nucleotide exchange factors for Rac family small G proteins. Structural domains of this protein include the catalytic diffuse B-cell lymphoma homology and pleckstrin homology (DHPH) domain, two disheveled, EGL-10, and pleckstrin homology (DEP) domains, two PDZ domains, and a C-terminal inositol polyphosphate-4 phosphatase (IP4P) domain that is found in one of the isoforms. This protein facilitates the exchange of GDP for GTP on Rac1, allowing the GTP-bound Rac1 to activate downstream effectors. Studies also show that the pleckstrin homology domain of this protein interacts with the phosphatase and tensin homolog (PTEN) gene product to inhibit PTEN phosphatase activity, thus activating the phosphoinositide-3 kinase (PI3K) signaling pathway. Conversely, the PTEN gene product has also been shown to inhibit the GEF activity of this protein. This gene plays a role in insulin-signaling pathways, and either mutations or overexpression of this gene have been observed in some cancers. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for gene trapped alleles may exhibit abnormal Purkinje cell dendrite morphology, a mild motor coordination defect that progressively worsens with age, hypoactivity, impaired glucose tolerance and/or insulin resistance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgra1	G	A	7: 139,845,648	A26T	possibly damaging	Het
Adgrg3	T	A	8: 95,033,373	Y73*	probably null	Het
Alk	A	T	17: 71,911,567	V761E	probably damaging	Het
Ankrd13a	T	C	5: 114,786,733	V93A	possibly damaging	Het
Anks1b	T	C	10: 90,511,184		probably null	Het
Ascl1	T	C	10: 87,492,793	N99S	probably benign	Het
Atm	A	T	9: 53,500,932	L972Q	probably damaging	Het
Atp2c1	A	T	9: 105,432,797	L566Q	probably null	Het
Bank1	T	A	3: 136,093,296	Y629F	probably damaging	Het
Bod1l	G	T	5: 41,816,775	L2399I	probably benign	Het
Bub1b	G	A	2: 118,641,189	G1010D	probably benign	Het
Ces1b	G	A	8: 93,056,904	H563Y	possibly damaging	Het
Cfap70	T	C	14: 20,404,157	E853G	probably benign	Het
Cfh	T	C	1: 140,105,523	E779G	probably benign	Het
Cox7c	A	G	13: 86,045,884	S7P	probably benign	Het
Cyp2c67	A	G	19: 39,643,590		probably null	Het
Dhx30	G	T	9: 110,085,445	L995I	possibly damaging	Het
Dhx30	G	C	9: 110,085,446	N957K	possibly damaging	Het
Dsc3	T	C	18: 19,991,560	T36A	possibly damaging	Het
Dstyk	A	G	1: 132,456,919	D717G	probably damaging	Het
Dusp10	A	G	1: 184,036,858	D7G	probably damaging	Het
E230001N04Rik	T	G	17: 28,523,961		noncoding transcript	Het
Ece2	T	C	16: 20,637,838	S330P	possibly damaging	Het
Fam172a	T	A	13: 77,759,516	M1K	probably null	Het
Frmd5	ATAGTGGAATTGTTCAAACTC	ATAGTGGAATTGTTCAAACTCTAGTGGAATTGTTCAAACTC	2: 121,548,730		probably null	Het
Gata3	T	C	2: 9,877,549	H14R	possibly damaging	Het
Ggta1	T	A	2: 35,414,283	I75F	possibly damaging	Het
Hcn1	A	T	13: 117,603,073	I124F	unknown	Het
Herpud1	A	C	8: 94,389,366	D53A	probably damaging	Het
Inhba	T	A	13: 16,026,624	L257Q	possibly damaging	Het
Itga10	C	T	3: 96,651,738		probably benign	Het
Jmy	T	A	13: 93,498,370	S313C	probably damaging	Het
Lpo	G	A	11: 87,807,241		probably benign	Het
Lsg1	T	C	16: 30,571,352	E315G	probably damaging	Het
Lsm14a	T	A	7: 34,365,654	T167S	possibly damaging	Het
Lsmem1	GTACATACATACATACATACATACATACA	GTACATACATACATACATACATACATACATACA	12: 40,185,261		probably null	Het
Map3k2	T	C	18: 32,203,792		probably benign	Het
Mapk12	A	T	15: 89,140,141	M81K	probably damaging	Het
Matn2	T	A	15: 34,378,732	C305S	probably damaging	Het
Mgam	T	C	6: 40,677,044	Y844H	possibly damaging	Het
Mgat5b	A	G	11: 116,947,377	R281G	probably benign	Het
Mon1b	T	G	8: 113,641,957	C497G	probably damaging	Het
Mybbp1a	A	T	11: 72,445,217	H452L	probably benign	Het
Mybl2	A	G	2: 163,075,696	T41A	probably damaging	Het
Ncoa5	A	G	2: 165,001,703	V540A	probably damaging	Het
Nup93	T	A	8: 94,292,687	V47E	possibly damaging	Het
Olfr1052	A	G	2: 86,298,736	M307V	probably null	Het
Olfr17	A	T	7: 107,097,770	M102L	probably benign	Het
Orc6	T	A	8: 85,305,285	C100S	possibly damaging	Het
Otogl	G	T	10: 107,813,965	Y1176*	probably null	Het
Patj	A	T	4: 98,413,027	D183V	probably damaging	Het
Pik3r3	A	G	4: 116,222,317	T4A	probably damaging	Het
Pla2g4d	G	A	2: 120,270,150		probably benign	Het
Pla2r1	A	G	2: 60,420,257	I1407T	probably benign	Het
Pramef12	A	T	4: 144,393,036	C320*	probably null	Het
Prkca	A	G	11: 107,983,946	V390A	probably damaging	Het
Psmd13	T	A	7: 140,890,609	W255R	probably damaging	Het
Rec8	T	A	14: 55,618,796	N37K	probably damaging	Het
Rnf207	C	T	4: 152,313,215	E361K	probably benign	Het
Serpina3f	T	A	12: 104,217,440	L187Q	probably damaging	Het
Skint11	A	T	4: 114,194,781	T109S	probably damaging	Het
Slc7a8	A	G	14: 54,724,849	S443P	probably damaging	Het
Slc8b1	T	A	5: 120,521,082	F197Y	probably benign	Het
Sox2	T	C	3: 34,650,419	Y2H	probably damaging	Het
Speg	T	A	1: 75,410,549		probably benign	Het
Tlr3	T	C	8: 45,400,837	N149D	probably benign	Het
Trim60	A	C	8: 65,001,464	D44E	probably benign	Het
Ugt1a7c	A	G	1: 88,095,935	Y272C	probably damaging	Het
Vmn1r4	T	A	6: 56,956,753	Y81N	probably damaging	Het
Vmn2r73	A	T	7: 85,857,681	C808S	probably benign	Het
Ythdf3	T	C	3: 16,204,892	I412T	possibly damaging	Het
Zfp672	T	C	11: 58,316,095	T467A	possibly damaging	Het
Zfp985	A	T	4: 147,583,950	Q425L	possibly damaging	Het

Other mutations in Prex2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00497:Prex2	APN	1	11186652	missense	possibly damaging	0.51
IGL00948:Prex2	APN	1	11170614	missense	probably damaging	0.98
IGL01087:Prex2	APN	1	11068104	missense	probably benign	0.00
IGL01490:Prex2	APN	1	11184545	splice site	probably null
IGL01533:Prex2	APN	1	11186741	nonsense	probably null
IGL01661:Prex2	APN	1	11208614	missense	probably benign	0.01
IGL01668:Prex2	APN	1	11153645	missense	probably benign	0.00
IGL01674:Prex2	APN	1	11170741	missense	probably damaging	1.00
IGL01716:Prex2	APN	1	11266054	missense	probably benign	0.04
IGL01867:Prex2	APN	1	11098503	missense	probably benign	0.11
IGL01954:Prex2	APN	1	11140011	missense	possibly damaging	0.75
IGL01990:Prex2	APN	1	11123233	splice site	probably benign
IGL02022:Prex2	APN	1	11297739	missense	probably benign	0.04
IGL02130:Prex2	APN	1	11112799	missense	probably damaging	1.00
IGL02130:Prex2	APN	1	11160162	missense	probably damaging	1.00
IGL02221:Prex2	APN	1	11061345	missense	probably benign	0.00
IGL02369:Prex2	APN	1	11101169	critical splice donor site	probably null
IGL02440:Prex2	APN	1	11153657	missense	possibly damaging	0.94
IGL02477:Prex2	APN	1	11204154	missense	probably benign
IGL02492:Prex2	APN	1	11123845	missense	possibly damaging	0.93
IGL03051:Prex2	APN	1	11142665	missense	probably damaging	1.00
IGL03154:Prex2	APN	1	11153633	missense	possibly damaging	0.63
IGL03158:Prex2	APN	1	11266067	missense	possibly damaging	0.89
IGL03308:Prex2	APN	1	11185175	missense	possibly damaging	0.89
IGL03338:Prex2	APN	1	11140265	missense	probably benign	0.01
R0042:Prex2	UTSW	1	11080081	missense	probably damaging	1.00
R0052:Prex2	UTSW	1	11160156	missense	probably damaging	1.00
R0052:Prex2	UTSW	1	11160156	missense	probably damaging	1.00
R0138:Prex2	UTSW	1	11285043	splice site	probably benign
R0206:Prex2	UTSW	1	11285144	missense	probably damaging	1.00
R0206:Prex2	UTSW	1	11285144	missense	probably damaging	1.00
R0208:Prex2	UTSW	1	11285144	missense	probably damaging	1.00
R0325:Prex2	UTSW	1	11200057	splice site	probably null
R0326:Prex2	UTSW	1	11285065	missense	probably damaging	1.00
R0390:Prex2	UTSW	1	11089706	splice site	probably null
R0492:Prex2	UTSW	1	11186633	splice site	probably benign
R0512:Prex2	UTSW	1	11199933	missense	probably benign
R0515:Prex2	UTSW	1	11199874	missense	probably damaging	0.99
R0894:Prex2	UTSW	1	11181898	missense	probably benign
R1259:Prex2	UTSW	1	11289270	missense	probably damaging	1.00
R1332:Prex2	UTSW	1	11204091	missense	probably damaging	1.00
R1356:Prex2	UTSW	1	11080092	nonsense	probably null
R1451:Prex2	UTSW	1	11156259	missense	probably benign	0.01
R1488:Prex2	UTSW	1	11193528	missense	probably benign	0.05
R1512:Prex2	UTSW	1	11061330	missense	possibly damaging	0.64
R1641:Prex2	UTSW	1	11231772	missense	probably damaging	0.99
R1678:Prex2	UTSW	1	11285089	missense	possibly damaging	0.51
R1736:Prex2	UTSW	1	11089884	splice site	probably benign
R1781:Prex2	UTSW	1	11199955	missense	probably benign	0.17
R1804:Prex2	UTSW	1	11132342	missense	probably damaging	1.00
R1836:Prex2	UTSW	1	11136780	missense	probably damaging	1.00
R1899:Prex2	UTSW	1	11162366	nonsense	probably null
R1900:Prex2	UTSW	1	11162366	nonsense	probably null
R2020:Prex2	UTSW	1	11162312	missense	probably damaging	0.98
R2114:Prex2	UTSW	1	11186713	missense	probably damaging	1.00
R2117:Prex2	UTSW	1	11186713	missense	probably damaging	1.00
R2436:Prex2	UTSW	1	11266152	missense	possibly damaging	0.90
R2902:Prex2	UTSW	1	11208614	missense	possibly damaging	0.77
R2915:Prex2	UTSW	1	11169853	missense	probably damaging	1.00
R2924:Prex2	UTSW	1	11098487	missense	probably damaging	1.00
R2981:Prex2	UTSW	1	11181962	missense	probably damaging	1.00
R3430:Prex2	UTSW	1	11149854	missense	possibly damaging	0.88
R3832:Prex2	UTSW	1	11156364	splice site	probably benign
R3870:Prex2	UTSW	1	11160192	missense	possibly damaging	0.86
R3963:Prex2	UTSW	1	11110357	missense	possibly damaging	0.93
R4012:Prex2	UTSW	1	11184516	missense	probably benign
R4030:Prex2	UTSW	1	11208568	missense	probably benign	0.06
R4214:Prex2	UTSW	1	11101159	missense	probably damaging	1.00
R4214:Prex2	UTSW	1	11285061	missense	probably damaging	1.00
R4242:Prex2	UTSW	1	11156304	missense	probably benign	0.06
R4490:Prex2	UTSW	1	11162263	missense	probably benign	0.05
R4491:Prex2	UTSW	1	11162263	missense	probably benign	0.05
R4492:Prex2	UTSW	1	11162263	missense	probably benign	0.05
R4561:Prex2	UTSW	1	11184545	splice site	probably null
R4624:Prex2	UTSW	1	11289265	nonsense	probably null
R4647:Prex2	UTSW	1	11162285	missense	probably damaging	1.00
R4657:Prex2	UTSW	1	11065825	missense	probably benign	0.00
R4706:Prex2	UTSW	1	11199988	missense	probably damaging	1.00
R4806:Prex2	UTSW	1	11068020	missense	probably damaging	1.00
R4900:Prex2	UTSW	1	11149905	splice site	probably benign
R4922:Prex2	UTSW	1	11169940	missense	probably damaging	1.00
R4961:Prex2	UTSW	1	11098481	missense	possibly damaging	0.75
R5284:Prex2	UTSW	1	11266090	nonsense	probably null
R5305:Prex2	UTSW	1	11107678	missense	probably damaging	1.00
R5307:Prex2	UTSW	1	11200032	missense	probably damaging	0.99
R5331:Prex2	UTSW	1	11140011	missense	possibly damaging	0.75
R5385:Prex2	UTSW	1	11139980	missense	probably damaging	0.99
R5574:Prex2	UTSW	1	11140058	missense	probably damaging	1.00
R5979:Prex2	UTSW	1	11132372	missense	probably damaging	1.00
R6076:Prex2	UTSW	1	11185950	missense	probably benign	0.09
R6160:Prex2	UTSW	1	10993851	missense	probably damaging	1.00
R6177:Prex2	UTSW	1	11136777	missense	possibly damaging	0.49
R6221:Prex2	UTSW	1	11266012	missense	probably benign	0.01
R6293:Prex2	UTSW	1	11162298	missense	probably benign
R6335:Prex2	UTSW	1	11110320	missense	probably benign	0.13
R6401:Prex2	UTSW	1	11186727	missense	probably benign	0.00
R6427:Prex2	UTSW	1	11182031	missense	probably damaging	1.00
R6467:Prex2	UTSW	1	11266035	missense	probably damaging	1.00
R6564:Prex2	UTSW	1	11101061	splice site	probably null
R6734:Prex2	UTSW	1	11080059	missense	probably damaging	1.00
R6753:Prex2	UTSW	1	11184456	missense	probably damaging	0.98
R6880:Prex2	UTSW	1	11132384	missense	probably damaging	1.00
R6973:Prex2	UTSW	1	11112743	missense	probably damaging	1.00
R6980:Prex2	UTSW	1	11162263	missense	probably benign	0.05
R6987:Prex2	UTSW	1	11170752	missense	probably damaging	0.99
R7085:Prex2	UTSW	1	11098588	missense	possibly damaging	0.73
R7101:Prex2	UTSW	1	11153609	missense	possibly damaging	0.86
R7106:Prex2	UTSW	1	11136793	missense	probably benign	0.33
R7319:Prex2	UTSW	1	11162308	missense	probably benign	0.10
R7342:Prex2	UTSW	1	11162325	missense	probably benign	0.00
R7469:Prex2	UTSW	1	11285069	missense	probably damaging	1.00
R7528:Prex2	UTSW	1	11204092	missense	probably damaging	1.00
R7592:Prex2	UTSW	1	11123213	missense	probably damaging	1.00
R7650:Prex2	UTSW	1	11149854	missense	possibly damaging	0.67
R7695:Prex2	UTSW	1	11162273	missense	probably benign	0.00
R7720:Prex2	UTSW	1	11181937	missense	possibly damaging	0.47
R7733:Prex2	UTSW	1	11181959	missense	probably benign	0.31
R7859:Prex2	UTSW	1	11080050	missense	probably damaging	1.00
R8247:Prex2	UTSW	1	11199970	missense	probably benign
R8300:Prex2	UTSW	1	11231718	missense	possibly damaging	0.49
R8345:Prex2	UTSW	1	11199894	missense	possibly damaging	0.65
R8352:Prex2	UTSW	1	11285139	missense	probably benign
R8352:Prex2	UTSW	1	11285140	missense	probably benign
R8410:Prex2	UTSW	1	11153657	missense	possibly damaging	0.94
R8452:Prex2	UTSW	1	11285139	missense	probably benign
R8452:Prex2	UTSW	1	11285140	missense	probably benign
RF005:Prex2	UTSW	1	11185166	missense	possibly damaging	0.47
Z1177:Prex2	UTSW	1	11289252	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- CTGAGAACCAGTTGACACTGATGAGAG -3'
(R):5'- CCACCTAAATAATGTGATGGCAGCCAG -3'

Sequencing Primer
(F):5'- CAGTTGACACTGATGAGAGATTTTCC -3'
(R):5'- ACAGGAAGTTCTGTTCCTTCAG -3'

Posted On

2014-05-09