Mutagenetix > Incidental Mutations

Incidental Mutation 'R1667:Itga10'

187266

Institutional Source

Beutler Lab

Gene Symbol

Itga10

Ensembl Gene

ENSMUSG00000090210

Gene Name

integrin, alpha 10

Synonyms

MMRRC Submission

039703-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.129) question?

Stock #

R1667 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

96645584-96664519 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

C to T at 96651738 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000121011 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029744] [ENSMUST00000119365] [ENSMUST00000137564]

Predicted Effect

probably benign
Transcript: ENSMUST00000029744

SMART Domains

Protein: ENSMUSP00000029744
Gene: ENSMUSG00000090210

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Int_alpha	37	93	9.03e-3	SMART
VWA	165	355	9.6e-43	SMART
Int_alpha	427	481	2.01e0	SMART
Int_alpha	482	539	5.14e-7	SMART
Int_alpha	545	600	5.34e-14	SMART
Int_alpha	607	652	8.75e0	SMART
transmembrane domain	1123	1145	N/A	INTRINSIC
low complexity region	1153	1166	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000119365

SMART Domains

Protein: ENSMUSP00000112393
Gene: ENSMUSG00000090210

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Int_alpha	37	93	9.03e-3	SMART
VWA	165	355	9.6e-43	SMART
Int_alpha	427	481	2.01e0	SMART
Int_alpha	482	539	5.14e-7	SMART
Int_alpha	545	600	5.34e-14	SMART
Int_alpha	607	652	8.75e0	SMART
transmembrane domain	1122	1144	N/A	INTRINSIC
low complexity region	1152	1165	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000137564

SMART Domains

Protein: ENSMUSP00000121011
Gene: ENSMUSG00000106447

Domain	Start	End	E-Value	Type
Pfam:PEX11	1	172	4.5e-57	PFAM
low complexity region	186	204	N/A	INTRINSIC
Int_alpha	222	278	9.03e-3	SMART
Blast:VWA	292	345	3e-7	BLAST

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.0%

Validation Efficiency

99% (76/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are integral transmembrane glycoproteins composed of noncovalently linked alpha and beta chains. They participate in cell adhesion as well as cell-surface mediated signalling. This gene encodes an integrin alpha chain and is expressed at high levels in chondrocytes, where it is transcriptionally regulated by AP-2epsilon and Ets-1. The protein encoded by this gene binds to collagen. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous null mice display slightly shortened long bones and amild abnormalities in ephysiseal plate morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgra1	G	A	7: 139,845,648	A26T	possibly damaging	Het
Adgrg3	T	A	8: 95,033,373	Y73*	probably null	Het
Alk	A	T	17: 71,911,567	V761E	probably damaging	Het
Ankrd13a	T	C	5: 114,786,733	V93A	possibly damaging	Het
Anks1b	T	C	10: 90,511,184		probably null	Het
Ascl1	T	C	10: 87,492,793	N99S	probably benign	Het
Atm	A	T	9: 53,500,932	L972Q	probably damaging	Het
Atp2c1	A	T	9: 105,432,797	L566Q	probably null	Het
Bank1	T	A	3: 136,093,296	Y629F	probably damaging	Het
Bod1l	G	T	5: 41,816,775	L2399I	probably benign	Het
Bub1b	G	A	2: 118,641,189	G1010D	probably benign	Het
Ces1b	G	A	8: 93,056,904	H563Y	possibly damaging	Het
Cfap70	T	C	14: 20,404,157	E853G	probably benign	Het
Cfh	T	C	1: 140,105,523	E779G	probably benign	Het
Cox7c	A	G	13: 86,045,884	S7P	probably benign	Het
Cyp2c67	A	G	19: 39,643,590		probably null	Het
Dhx30	G	T	9: 110,085,445	L995I	possibly damaging	Het
Dhx30	G	C	9: 110,085,446	N957K	possibly damaging	Het
Dsc3	T	C	18: 19,991,560	T36A	possibly damaging	Het
Dstyk	A	G	1: 132,456,919	D717G	probably damaging	Het
Dusp10	A	G	1: 184,036,858	D7G	probably damaging	Het
E230001N04Rik	T	G	17: 28,523,961		noncoding transcript	Het
Ece2	T	C	16: 20,637,838	S330P	possibly damaging	Het
Fam172a	T	A	13: 77,759,516	M1K	probably null	Het
Frmd5	ATAGTGGAATTGTTCAAACTC	ATAGTGGAATTGTTCAAACTCTAGTGGAATTGTTCAAACTC	2: 121,548,730		probably null	Het
Gata3	T	C	2: 9,877,549	H14R	possibly damaging	Het
Ggta1	T	A	2: 35,414,283	I75F	possibly damaging	Het
Hcn1	A	T	13: 117,603,073	I124F	unknown	Het
Herpud1	A	C	8: 94,389,366	D53A	probably damaging	Het
Inhba	T	A	13: 16,026,624	L257Q	possibly damaging	Het
Jmy	T	A	13: 93,498,370	S313C	probably damaging	Het
Lpo	G	A	11: 87,807,241		probably benign	Het
Lsg1	T	C	16: 30,571,352	E315G	probably damaging	Het
Lsm14a	T	A	7: 34,365,654	T167S	possibly damaging	Het
Lsmem1	GTACATACATACATACATACATACATACA	GTACATACATACATACATACATACATACATACA	12: 40,185,261		probably null	Het
Map3k2	T	C	18: 32,203,792		probably benign	Het
Mapk12	A	T	15: 89,140,141	M81K	probably damaging	Het
Matn2	T	A	15: 34,378,732	C305S	probably damaging	Het
Mgam	T	C	6: 40,677,044	Y844H	possibly damaging	Het
Mgat5b	A	G	11: 116,947,377	R281G	probably benign	Het
Mon1b	T	G	8: 113,641,957	C497G	probably damaging	Het
Mybbp1a	A	T	11: 72,445,217	H452L	probably benign	Het
Mybl2	A	G	2: 163,075,696	T41A	probably damaging	Het
Ncoa5	A	G	2: 165,001,703	V540A	probably damaging	Het
Nup93	T	A	8: 94,292,687	V47E	possibly damaging	Het
Olfr1052	A	G	2: 86,298,736	M307V	probably null	Het
Olfr17	A	T	7: 107,097,770	M102L	probably benign	Het
Orc6	T	A	8: 85,305,285	C100S	possibly damaging	Het
Otogl	G	T	10: 107,813,965	Y1176*	probably null	Het
Patj	A	T	4: 98,413,027	D183V	probably damaging	Het
Pik3r3	A	G	4: 116,222,317	T4A	probably damaging	Het
Pla2g4d	G	A	2: 120,270,150		probably benign	Het
Pla2r1	A	G	2: 60,420,257	I1407T	probably benign	Het
Pramef12	A	T	4: 144,393,036	C320*	probably null	Het
Prex2	A	T	1: 11,186,757	H1231L	probably benign	Het
Prkca	A	G	11: 107,983,946	V390A	probably damaging	Het
Psmd13	T	A	7: 140,890,609	W255R	probably damaging	Het
Rec8	T	A	14: 55,618,796	N37K	probably damaging	Het
Rnf207	C	T	4: 152,313,215	E361K	probably benign	Het
Serpina3f	T	A	12: 104,217,440	L187Q	probably damaging	Het
Skint11	A	T	4: 114,194,781	T109S	probably damaging	Het
Slc7a8	A	G	14: 54,724,849	S443P	probably damaging	Het
Slc8b1	T	A	5: 120,521,082	F197Y	probably benign	Het
Sox2	T	C	3: 34,650,419	Y2H	probably damaging	Het
Speg	T	A	1: 75,410,549		probably benign	Het
Tlr3	T	C	8: 45,400,837	N149D	probably benign	Het
Trim60	A	C	8: 65,001,464	D44E	probably benign	Het
Ugt1a7c	A	G	1: 88,095,935	Y272C	probably damaging	Het
Vmn1r4	T	A	6: 56,956,753	Y81N	probably damaging	Het
Vmn2r73	A	T	7: 85,857,681	C808S	probably benign	Het
Ythdf3	T	C	3: 16,204,892	I412T	possibly damaging	Het
Zfp672	T	C	11: 58,316,095	T467A	possibly damaging	Het
Zfp985	A	T	4: 147,583,950	Q425L	possibly damaging	Het

Other mutations in Itga10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01473:Itga10	APN	3	96647641	missense	probably damaging	0.96
IGL01694:Itga10	APN	3	96652517	missense	probably damaging	0.99
IGL01754:Itga10	APN	3	96656775	unclassified	probably benign
IGL02527:Itga10	APN	3	96655624	unclassified	probably benign
IGL02956:Itga10	APN	3	96655113	missense	possibly damaging	0.46
IGL03371:Itga10	APN	3	96654788	missense	possibly damaging	0.84
IGL03055:Itga10	UTSW	3	96650520	missense	probably damaging	0.99
PIT4515001:Itga10	UTSW	3	96662632	missense	probably damaging	0.99
R0153:Itga10	UTSW	3	96653700	missense	probably benign	0.00
R0308:Itga10	UTSW	3	96651464	missense	probably damaging	1.00
R0331:Itga10	UTSW	3	96652483	missense	probably damaging	1.00
R0413:Itga10	UTSW	3	96649059	missense	probably damaging	1.00
R0437:Itga10	UTSW	3	96649137	missense	probably damaging	1.00
R0511:Itga10	UTSW	3	96658174	missense	probably damaging	1.00
R0630:Itga10	UTSW	3	96656299	unclassified	probably benign
R0844:Itga10	UTSW	3	96651738	splice site	probably benign
R0849:Itga10	UTSW	3	96652530	missense	possibly damaging	0.67
R0894:Itga10	UTSW	3	96653660	missense	possibly damaging	0.69
R0919:Itga10	UTSW	3	96651738	splice site	probably benign
R1027:Itga10	UTSW	3	96651738	splice site	probably benign
R1341:Itga10	UTSW	3	96652495	missense	probably damaging	1.00
R1350:Itga10	UTSW	3	96657477	missense	probably benign	0.01
R1370:Itga10	UTSW	3	96651738	splice site	probably benign
R1467:Itga10	UTSW	3	96652229	nonsense	probably null
R1467:Itga10	UTSW	3	96652229	nonsense	probably null
R1589:Itga10	UTSW	3	96651738	splice site	probably benign
R1590:Itga10	UTSW	3	96651738	splice site	probably benign
R1601:Itga10	UTSW	3	96653658	missense	possibly damaging	0.82
R1659:Itga10	UTSW	3	96662977	missense	probably damaging	0.96
R1665:Itga10	UTSW	3	96651738	splice site	probably benign
R1686:Itga10	UTSW	3	96651825	missense	probably damaging	0.97
R1972:Itga10	UTSW	3	96651738	splice site	probably benign
R1976:Itga10	UTSW	3	96651738	splice site	probably benign
R2020:Itga10	UTSW	3	96652490	missense	probably damaging	1.00
R2040:Itga10	UTSW	3	96651738	splice site	probably benign
R2044:Itga10	UTSW	3	96651738	splice site	probably benign
R2044:Itga10	UTSW	3	96657690	missense	probably benign
R2045:Itga10	UTSW	3	96651738	splice site	probably benign
R2060:Itga10	UTSW	3	96654998	nonsense	probably null
R2146:Itga10	UTSW	3	96651492	missense	possibly damaging	0.59
R2146:Itga10	UTSW	3	96653723	missense	probably damaging	1.00
R2170:Itga10	UTSW	3	96650457	missense	probably damaging	1.00
R2893:Itga10	UTSW	3	96655100	missense	probably benign	0.11
R2926:Itga10	UTSW	3	96652849	missense	probably damaging	1.00
R3622:Itga10	UTSW	3	96651738	splice site	probably benign
R3623:Itga10	UTSW	3	96651738	splice site	probably benign
R4416:Itga10	UTSW	3	96658246	missense	possibly damaging	0.58
R4633:Itga10	UTSW	3	96647704	missense	possibly damaging	0.92
R5074:Itga10	UTSW	3	96652211	nonsense	probably null
R5095:Itga10	UTSW	3	96648164	missense	probably benign	0.21
R5495:Itga10	UTSW	3	96647371	missense	possibly damaging	0.92
R5813:Itga10	UTSW	3	96652585	missense	probably benign	0.38
R6114:Itga10	UTSW	3	96649035	missense	probably damaging	1.00
R6172:Itga10	UTSW	3	96647437	missense	probably benign	0.18
R6275:Itga10	UTSW	3	96658185	missense	probably benign	0.36
R6298:Itga10	UTSW	3	96656762	missense	probably benign	0.00
R6433:Itga10	UTSW	3	96658041	critical splice donor site	probably null
R6841:Itga10	UTSW	3	96656714	missense	probably damaging	1.00
R6909:Itga10	UTSW	3	96662599	missense	probably benign	0.00
R6927:Itga10	UTSW	3	96656714	missense	probably damaging	1.00
R7124:Itga10	UTSW	3	96651765	missense	probably damaging	0.96
R7310:Itga10	UTSW	3	96648159	missense	probably damaging	1.00
R7387:Itga10	UTSW	3	96652778	missense	probably benign	0.11
R7464:Itga10	UTSW	3	96648155	missense	probably damaging	1.00
R7624:Itga10	UTSW	3	96652953	missense	probably benign
R7638:Itga10	UTSW	3	96657391	splice site	probably null
R7639:Itga10	UTSW	3	96649582	missense	probably benign	0.36
R7893:Itga10	UTSW	3	96649612	missense	probably damaging	1.00
R8297:Itga10	UTSW	3	96654800	missense	probably damaging	1.00
R8753:Itga10	UTSW	3	96651155	missense	probably damaging	1.00
X0064:Itga10	UTSW	3	96652936	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TTGGATAGACCCTGACCCTCTCAAC -3'
(R):5'- GGTTTCCTGAAGGCATAAGGCGAG -3'

Sequencing Primer
(F):5'- ATAAGCCCCCTACTTCTAATTCAG -3'
(R):5'- CTAAGGGGGAGTGCCTCATAC -3'

Posted On

2014-05-09