Incidental Mutation 'R1667:Itga10'
ID187266
Institutional Source Beutler Lab
Gene Symbol Itga10
Ensembl Gene ENSMUSG00000090210
Gene Nameintegrin, alpha 10
Synonyms
MMRRC Submission 039703-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R1667 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location96645584-96664519 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 96651738 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029744] [ENSMUST00000119365] [ENSMUST00000137564]
Predicted Effect probably benign
Transcript: ENSMUST00000029744
SMART Domains Protein: ENSMUSP00000029744
Gene: ENSMUSG00000090210

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Int_alpha 37 93 9.03e-3 SMART
VWA 165 355 9.6e-43 SMART
Int_alpha 427 481 2.01e0 SMART
Int_alpha 482 539 5.14e-7 SMART
Int_alpha 545 600 5.34e-14 SMART
Int_alpha 607 652 8.75e0 SMART
transmembrane domain 1123 1145 N/A INTRINSIC
low complexity region 1153 1166 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119365
SMART Domains Protein: ENSMUSP00000112393
Gene: ENSMUSG00000090210

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Int_alpha 37 93 9.03e-3 SMART
VWA 165 355 9.6e-43 SMART
Int_alpha 427 481 2.01e0 SMART
Int_alpha 482 539 5.14e-7 SMART
Int_alpha 545 600 5.34e-14 SMART
Int_alpha 607 652 8.75e0 SMART
transmembrane domain 1122 1144 N/A INTRINSIC
low complexity region 1152 1165 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137564
SMART Domains Protein: ENSMUSP00000121011
Gene: ENSMUSG00000106447

DomainStartEndE-ValueType
Pfam:PEX11 1 172 4.5e-57 PFAM
low complexity region 186 204 N/A INTRINSIC
Int_alpha 222 278 9.03e-3 SMART
Blast:VWA 292 345 3e-7 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are integral transmembrane glycoproteins composed of noncovalently linked alpha and beta chains. They participate in cell adhesion as well as cell-surface mediated signalling. This gene encodes an integrin alpha chain and is expressed at high levels in chondrocytes, where it is transcriptionally regulated by AP-2epsilon and Ets-1. The protein encoded by this gene binds to collagen. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous null mice display slightly shortened long bones and amild abnormalities in ephysiseal plate morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra1 G A 7: 139,845,648 A26T possibly damaging Het
Adgrg3 T A 8: 95,033,373 Y73* probably null Het
Alk A T 17: 71,911,567 V761E probably damaging Het
Ankrd13a T C 5: 114,786,733 V93A possibly damaging Het
Anks1b T C 10: 90,511,184 probably null Het
Ascl1 T C 10: 87,492,793 N99S probably benign Het
Atm A T 9: 53,500,932 L972Q probably damaging Het
Atp2c1 A T 9: 105,432,797 L566Q probably null Het
Bank1 T A 3: 136,093,296 Y629F probably damaging Het
Bod1l G T 5: 41,816,775 L2399I probably benign Het
Bub1b G A 2: 118,641,189 G1010D probably benign Het
Ces1b G A 8: 93,056,904 H563Y possibly damaging Het
Cfap70 T C 14: 20,404,157 E853G probably benign Het
Cfh T C 1: 140,105,523 E779G probably benign Het
Cox7c A G 13: 86,045,884 S7P probably benign Het
Cyp2c67 A G 19: 39,643,590 probably null Het
Dhx30 G T 9: 110,085,445 L995I possibly damaging Het
Dhx30 G C 9: 110,085,446 N957K possibly damaging Het
Dsc3 T C 18: 19,991,560 T36A possibly damaging Het
Dstyk A G 1: 132,456,919 D717G probably damaging Het
Dusp10 A G 1: 184,036,858 D7G probably damaging Het
E230001N04Rik T G 17: 28,523,961 noncoding transcript Het
Ece2 T C 16: 20,637,838 S330P possibly damaging Het
Fam172a T A 13: 77,759,516 M1K probably null Het
Frmd5 ATAGTGGAATTGTTCAAACTC ATAGTGGAATTGTTCAAACTCTAGTGGAATTGTTCAAACTC 2: 121,548,730 probably null Het
Gata3 T C 2: 9,877,549 H14R possibly damaging Het
Ggta1 T A 2: 35,414,283 I75F possibly damaging Het
Hcn1 A T 13: 117,603,073 I124F unknown Het
Herpud1 A C 8: 94,389,366 D53A probably damaging Het
Inhba T A 13: 16,026,624 L257Q possibly damaging Het
Jmy T A 13: 93,498,370 S313C probably damaging Het
Lpo G A 11: 87,807,241 probably benign Het
Lsg1 T C 16: 30,571,352 E315G probably damaging Het
Lsm14a T A 7: 34,365,654 T167S possibly damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Map3k2 T C 18: 32,203,792 probably benign Het
Mapk12 A T 15: 89,140,141 M81K probably damaging Het
Matn2 T A 15: 34,378,732 C305S probably damaging Het
Mgam T C 6: 40,677,044 Y844H possibly damaging Het
Mgat5b A G 11: 116,947,377 R281G probably benign Het
Mon1b T G 8: 113,641,957 C497G probably damaging Het
Mybbp1a A T 11: 72,445,217 H452L probably benign Het
Mybl2 A G 2: 163,075,696 T41A probably damaging Het
Ncoa5 A G 2: 165,001,703 V540A probably damaging Het
Nup93 T A 8: 94,292,687 V47E possibly damaging Het
Olfr1052 A G 2: 86,298,736 M307V probably null Het
Olfr17 A T 7: 107,097,770 M102L probably benign Het
Orc6 T A 8: 85,305,285 C100S possibly damaging Het
Otogl G T 10: 107,813,965 Y1176* probably null Het
Patj A T 4: 98,413,027 D183V probably damaging Het
Pik3r3 A G 4: 116,222,317 T4A probably damaging Het
Pla2g4d G A 2: 120,270,150 probably benign Het
Pla2r1 A G 2: 60,420,257 I1407T probably benign Het
Pramef12 A T 4: 144,393,036 C320* probably null Het
Prex2 A T 1: 11,186,757 H1231L probably benign Het
Prkca A G 11: 107,983,946 V390A probably damaging Het
Psmd13 T A 7: 140,890,609 W255R probably damaging Het
Rec8 T A 14: 55,618,796 N37K probably damaging Het
Rnf207 C T 4: 152,313,215 E361K probably benign Het
Serpina3f T A 12: 104,217,440 L187Q probably damaging Het
Skint11 A T 4: 114,194,781 T109S probably damaging Het
Slc7a8 A G 14: 54,724,849 S443P probably damaging Het
Slc8b1 T A 5: 120,521,082 F197Y probably benign Het
Sox2 T C 3: 34,650,419 Y2H probably damaging Het
Speg T A 1: 75,410,549 probably benign Het
Tlr3 T C 8: 45,400,837 N149D probably benign Het
Trim60 A C 8: 65,001,464 D44E probably benign Het
Ugt1a7c A G 1: 88,095,935 Y272C probably damaging Het
Vmn1r4 T A 6: 56,956,753 Y81N probably damaging Het
Vmn2r73 A T 7: 85,857,681 C808S probably benign Het
Ythdf3 T C 3: 16,204,892 I412T possibly damaging Het
Zfp672 T C 11: 58,316,095 T467A possibly damaging Het
Zfp985 A T 4: 147,583,950 Q425L possibly damaging Het
Other mutations in Itga10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Itga10 APN 3 96647641 missense probably damaging 0.96
IGL01694:Itga10 APN 3 96652517 missense probably damaging 0.99
IGL01754:Itga10 APN 3 96656775 unclassified probably benign
IGL02527:Itga10 APN 3 96655624 unclassified probably benign
IGL02956:Itga10 APN 3 96655113 missense possibly damaging 0.46
IGL03371:Itga10 APN 3 96654788 missense possibly damaging 0.84
IGL03055:Itga10 UTSW 3 96650520 missense probably damaging 0.99
PIT4515001:Itga10 UTSW 3 96662632 missense probably damaging 0.99
R0153:Itga10 UTSW 3 96653700 missense probably benign 0.00
R0308:Itga10 UTSW 3 96651464 missense probably damaging 1.00
R0331:Itga10 UTSW 3 96652483 missense probably damaging 1.00
R0413:Itga10 UTSW 3 96649059 missense probably damaging 1.00
R0437:Itga10 UTSW 3 96649137 missense probably damaging 1.00
R0511:Itga10 UTSW 3 96658174 missense probably damaging 1.00
R0630:Itga10 UTSW 3 96656299 unclassified probably benign
R0844:Itga10 UTSW 3 96651738 splice site probably benign
R0849:Itga10 UTSW 3 96652530 missense possibly damaging 0.67
R0894:Itga10 UTSW 3 96653660 missense possibly damaging 0.69
R0919:Itga10 UTSW 3 96651738 splice site probably benign
R1027:Itga10 UTSW 3 96651738 splice site probably benign
R1341:Itga10 UTSW 3 96652495 missense probably damaging 1.00
R1350:Itga10 UTSW 3 96657477 missense probably benign 0.01
R1370:Itga10 UTSW 3 96651738 splice site probably benign
R1467:Itga10 UTSW 3 96652229 nonsense probably null
R1467:Itga10 UTSW 3 96652229 nonsense probably null
R1589:Itga10 UTSW 3 96651738 splice site probably benign
R1590:Itga10 UTSW 3 96651738 splice site probably benign
R1601:Itga10 UTSW 3 96653658 missense possibly damaging 0.82
R1659:Itga10 UTSW 3 96662977 missense probably damaging 0.96
R1665:Itga10 UTSW 3 96651738 splice site probably benign
R1686:Itga10 UTSW 3 96651825 missense probably damaging 0.97
R1972:Itga10 UTSW 3 96651738 splice site probably benign
R1976:Itga10 UTSW 3 96651738 splice site probably benign
R2020:Itga10 UTSW 3 96652490 missense probably damaging 1.00
R2040:Itga10 UTSW 3 96651738 splice site probably benign
R2044:Itga10 UTSW 3 96651738 splice site probably benign
R2044:Itga10 UTSW 3 96657690 missense probably benign
R2045:Itga10 UTSW 3 96651738 splice site probably benign
R2060:Itga10 UTSW 3 96654998 nonsense probably null
R2146:Itga10 UTSW 3 96651492 missense possibly damaging 0.59
R2146:Itga10 UTSW 3 96653723 missense probably damaging 1.00
R2170:Itga10 UTSW 3 96650457 missense probably damaging 1.00
R2893:Itga10 UTSW 3 96655100 missense probably benign 0.11
R2926:Itga10 UTSW 3 96652849 missense probably damaging 1.00
R3622:Itga10 UTSW 3 96651738 splice site probably benign
R3623:Itga10 UTSW 3 96651738 splice site probably benign
R4416:Itga10 UTSW 3 96658246 missense possibly damaging 0.58
R4633:Itga10 UTSW 3 96647704 missense possibly damaging 0.92
R5074:Itga10 UTSW 3 96652211 nonsense probably null
R5095:Itga10 UTSW 3 96648164 missense probably benign 0.21
R5495:Itga10 UTSW 3 96647371 missense possibly damaging 0.92
R5813:Itga10 UTSW 3 96652585 missense probably benign 0.38
R6114:Itga10 UTSW 3 96649035 missense probably damaging 1.00
R6172:Itga10 UTSW 3 96647437 missense probably benign 0.18
R6275:Itga10 UTSW 3 96658185 missense probably benign 0.36
R6298:Itga10 UTSW 3 96656762 missense probably benign 0.00
R6433:Itga10 UTSW 3 96658041 critical splice donor site probably null
R6841:Itga10 UTSW 3 96656714 missense probably damaging 1.00
R6909:Itga10 UTSW 3 96662599 missense probably benign 0.00
R6927:Itga10 UTSW 3 96656714 missense probably damaging 1.00
R7124:Itga10 UTSW 3 96651765 missense probably damaging 0.96
R7310:Itga10 UTSW 3 96648159 missense probably damaging 1.00
R7387:Itga10 UTSW 3 96652778 missense probably benign 0.11
R7464:Itga10 UTSW 3 96648155 missense probably damaging 1.00
R7624:Itga10 UTSW 3 96652953 missense probably benign
R7638:Itga10 UTSW 3 96657391 intron probably null
R7639:Itga10 UTSW 3 96649582 missense probably benign 0.36
R7893:Itga10 UTSW 3 96649612 missense probably damaging 1.00
R7976:Itga10 UTSW 3 96649612 missense probably damaging 1.00
X0064:Itga10 UTSW 3 96652936 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTGGATAGACCCTGACCCTCTCAAC -3'
(R):5'- GGTTTCCTGAAGGCATAAGGCGAG -3'

Sequencing Primer
(F):5'- ATAAGCCCCCTACTTCTAATTCAG -3'
(R):5'- CTAAGGGGGAGTGCCTCATAC -3'
Posted On2014-05-09