Incidental Mutation 'R1667:Atp2c1'
ID187296
Institutional Source Beutler Lab
Gene Symbol Atp2c1
Ensembl Gene ENSMUSG00000032570
Gene NameATPase, Ca++-sequestering
SynonymsD930003G21Rik, SPCA, ATP2C1A, PMR1, 1700121J11Rik
MMRRC Submission 039703-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.360) question?
Stock #R1667 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location105403539-105527319 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 105432797 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 566 (L566Q)
Ref Sequence ENSEMBL: ENSMUSP00000082220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038118] [ENSMUST00000085133] [ENSMUST00000112558] [ENSMUST00000163879] [ENSMUST00000176770] [ENSMUST00000176770] [ENSMUST00000177074] [ENSMUST00000177074] [ENSMUST00000177293]
Predicted Effect probably null
Transcript: ENSMUST00000038118
AA Change: L532Q

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000039103
Gene: ENSMUSG00000032570
AA Change: L532Q

DomainStartEndE-ValueType
Cation_ATPase_N 25 99 1.85e-14 SMART
Pfam:E1-E2_ATPase 105 339 2.3e-75 PFAM
Pfam:Hydrolase 343 655 2.9e-31 PFAM
Pfam:HAD 346 652 7.7e-15 PFAM
Pfam:Hydrolase_like2 408 492 9.5e-20 PFAM
low complexity region 706 721 N/A INTRINSIC
Pfam:Cation_ATPase_C 725 897 4e-47 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000085133
AA Change: L566Q

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000082220
Gene: ENSMUSG00000032570
AA Change: L566Q

DomainStartEndE-ValueType
Cation_ATPase_N 59 133 1.85e-14 SMART
Pfam:E1-E2_ATPase 138 372 3.4e-62 PFAM
Pfam:Hydrolase 377 689 2.6e-23 PFAM
Pfam:HAD 380 686 7.8e-14 PFAM
Pfam:Cation_ATPase 442 526 3.2e-19 PFAM
low complexity region 740 755 N/A INTRINSIC
Pfam:Cation_ATPase_C 759 931 3.8e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112557
Predicted Effect probably null
Transcript: ENSMUST00000112558
AA Change: L532Q

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108177
Gene: ENSMUSG00000032570
AA Change: L532Q

DomainStartEndE-ValueType
Cation_ATPase_N 25 99 1.85e-14 SMART
Pfam:E1-E2_ATPase 105 339 2.3e-75 PFAM
Pfam:Hydrolase 343 655 2.9e-31 PFAM
Pfam:HAD 346 652 7.7e-15 PFAM
Pfam:Hydrolase_like2 408 492 9.5e-20 PFAM
low complexity region 706 721 N/A INTRINSIC
Pfam:Cation_ATPase_C 725 897 4e-47 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000163879
AA Change: L516Q

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129617
Gene: ENSMUSG00000032570
AA Change: L516Q

DomainStartEndE-ValueType
Cation_ATPase_N 9 83 1.85e-14 SMART
Pfam:E1-E2_ATPase 89 323 5.2e-76 PFAM
Pfam:Hydrolase 327 639 5.6e-32 PFAM
Pfam:HAD 330 636 1.4e-15 PFAM
Pfam:Hydrolase_like2 392 476 3.2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176656
Predicted Effect probably null
Transcript: ENSMUST00000176770
AA Change: L527Q

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000134764
Gene: ENSMUSG00000032570
AA Change: L527Q

DomainStartEndE-ValueType
Pfam:E1-E2_ATPase 100 334 8.9e-76 PFAM
Pfam:Hydrolase 338 650 1.1e-31 PFAM
Pfam:HAD 341 647 2.7e-15 PFAM
Pfam:Hydrolase_like2 403 487 4.8e-20 PFAM
low complexity region 701 716 N/A INTRINSIC
Pfam:Cation_ATPase_C 720 892 1.6e-47 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000176770
AA Change: L527Q

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000134764
Gene: ENSMUSG00000032570
AA Change: L527Q

DomainStartEndE-ValueType
Pfam:E1-E2_ATPase 100 334 8.9e-76 PFAM
Pfam:Hydrolase 338 650 1.1e-31 PFAM
Pfam:HAD 341 647 2.7e-15 PFAM
Pfam:Hydrolase_like2 403 487 4.8e-20 PFAM
low complexity region 701 716 N/A INTRINSIC
Pfam:Cation_ATPase_C 720 892 1.6e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177000
Predicted Effect probably null
Transcript: ENSMUST00000177074
AA Change: L532Q

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135646
Gene: ENSMUSG00000032570
AA Change: L532Q

DomainStartEndE-ValueType
Cation_ATPase_N 25 99 1.85e-14 SMART
Pfam:E1-E2_ATPase 105 339 8.2e-76 PFAM
Pfam:Hydrolase 343 655 1e-31 PFAM
Pfam:HAD 346 652 2.5e-15 PFAM
Pfam:Hydrolase_like2 408 492 4.5e-20 PFAM
low complexity region 706 721 N/A INTRINSIC
Pfam:Cation_ATPase_C 725 886 7e-44 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000177074
AA Change: L532Q

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135646
Gene: ENSMUSG00000032570
AA Change: L532Q

DomainStartEndE-ValueType
Cation_ATPase_N 25 99 1.85e-14 SMART
Pfam:E1-E2_ATPase 105 339 8.2e-76 PFAM
Pfam:Hydrolase 343 655 1e-31 PFAM
Pfam:HAD 346 652 2.5e-15 PFAM
Pfam:Hydrolase_like2 408 492 4.5e-20 PFAM
low complexity region 706 721 N/A INTRINSIC
Pfam:Cation_ATPase_C 725 886 7e-44 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000177293
AA Change: L396Q

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135802
Gene: ENSMUSG00000032570
AA Change: L396Q

DomainStartEndE-ValueType
Pfam:E1-E2_ATPase 1 203 6.7e-64 PFAM
Pfam:Hydrolase 207 519 7.4e-32 PFAM
Pfam:HAD 210 516 1.9e-15 PFAM
Pfam:Hydrolase_like2 272 356 3.8e-20 PFAM
transmembrane domain 564 586 N/A INTRINSIC
Pfam:Cation_ATPase_C 589 761 1.2e-47 PFAM
Meta Mutation Damage Score 0.2867 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases. This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the transport of calcium ions. Defects in this gene cause Hailey-Hailey disease, an autosomal dominant disorder. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele show embryonic growth retardation, failure of rostral neural tube closure, Golgi and endoplasmic reticulum stress, increased apoptosis, accumulation of intracellular lipid droplets and midgestational lethality. Agedheterozygotes develop squamous cell tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra1 G A 7: 139,845,648 A26T possibly damaging Het
Adgrg3 T A 8: 95,033,373 Y73* probably null Het
Alk A T 17: 71,911,567 V761E probably damaging Het
Ankrd13a T C 5: 114,786,733 V93A possibly damaging Het
Anks1b T C 10: 90,511,184 probably null Het
Ascl1 T C 10: 87,492,793 N99S probably benign Het
Atm A T 9: 53,500,932 L972Q probably damaging Het
Bank1 T A 3: 136,093,296 Y629F probably damaging Het
Bod1l G T 5: 41,816,775 L2399I probably benign Het
Bub1b G A 2: 118,641,189 G1010D probably benign Het
Ces1b G A 8: 93,056,904 H563Y possibly damaging Het
Cfap70 T C 14: 20,404,157 E853G probably benign Het
Cfh T C 1: 140,105,523 E779G probably benign Het
Cox7c A G 13: 86,045,884 S7P probably benign Het
Cyp2c67 A G 19: 39,643,590 probably null Het
Dhx30 G T 9: 110,085,445 L995I possibly damaging Het
Dhx30 G C 9: 110,085,446 N957K possibly damaging Het
Dsc3 T C 18: 19,991,560 T36A possibly damaging Het
Dstyk A G 1: 132,456,919 D717G probably damaging Het
Dusp10 A G 1: 184,036,858 D7G probably damaging Het
E230001N04Rik T G 17: 28,523,961 noncoding transcript Het
Ece2 T C 16: 20,637,838 S330P possibly damaging Het
Fam172a T A 13: 77,759,516 M1K probably null Het
Frmd5 ATAGTGGAATTGTTCAAACTC ATAGTGGAATTGTTCAAACTCTAGTGGAATTGTTCAAACTC 2: 121,548,730 probably null Het
Gata3 T C 2: 9,877,549 H14R possibly damaging Het
Ggta1 T A 2: 35,414,283 I75F possibly damaging Het
Hcn1 A T 13: 117,603,073 I124F unknown Het
Herpud1 A C 8: 94,389,366 D53A probably damaging Het
Inhba T A 13: 16,026,624 L257Q possibly damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Jmy T A 13: 93,498,370 S313C probably damaging Het
Lpo G A 11: 87,807,241 probably benign Het
Lsg1 T C 16: 30,571,352 E315G probably damaging Het
Lsm14a T A 7: 34,365,654 T167S possibly damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Map3k2 T C 18: 32,203,792 probably benign Het
Mapk12 A T 15: 89,140,141 M81K probably damaging Het
Matn2 T A 15: 34,378,732 C305S probably damaging Het
Mgam T C 6: 40,677,044 Y844H possibly damaging Het
Mgat5b A G 11: 116,947,377 R281G probably benign Het
Mon1b T G 8: 113,641,957 C497G probably damaging Het
Mybbp1a A T 11: 72,445,217 H452L probably benign Het
Mybl2 A G 2: 163,075,696 T41A probably damaging Het
Ncoa5 A G 2: 165,001,703 V540A probably damaging Het
Nup93 T A 8: 94,292,687 V47E possibly damaging Het
Olfr1052 A G 2: 86,298,736 M307V probably null Het
Olfr17 A T 7: 107,097,770 M102L probably benign Het
Orc6 T A 8: 85,305,285 C100S possibly damaging Het
Otogl G T 10: 107,813,965 Y1176* probably null Het
Patj A T 4: 98,413,027 D183V probably damaging Het
Pik3r3 A G 4: 116,222,317 T4A probably damaging Het
Pla2g4d G A 2: 120,270,150 probably benign Het
Pla2r1 A G 2: 60,420,257 I1407T probably benign Het
Pramef12 A T 4: 144,393,036 C320* probably null Het
Prex2 A T 1: 11,186,757 H1231L probably benign Het
Prkca A G 11: 107,983,946 V390A probably damaging Het
Psmd13 T A 7: 140,890,609 W255R probably damaging Het
Rec8 T A 14: 55,618,796 N37K probably damaging Het
Rnf207 C T 4: 152,313,215 E361K probably benign Het
Serpina3f T A 12: 104,217,440 L187Q probably damaging Het
Skint11 A T 4: 114,194,781 T109S probably damaging Het
Slc7a8 A G 14: 54,724,849 S443P probably damaging Het
Slc8b1 T A 5: 120,521,082 F197Y probably benign Het
Sox2 T C 3: 34,650,419 Y2H probably damaging Het
Speg T A 1: 75,410,549 probably benign Het
Tlr3 T C 8: 45,400,837 N149D probably benign Het
Trim60 A C 8: 65,001,464 D44E probably benign Het
Ugt1a7c A G 1: 88,095,935 Y272C probably damaging Het
Vmn1r4 T A 6: 56,956,753 Y81N probably damaging Het
Vmn2r73 A T 7: 85,857,681 C808S probably benign Het
Ythdf3 T C 3: 16,204,892 I412T possibly damaging Het
Zfp672 T C 11: 58,316,095 T467A possibly damaging Het
Zfp985 A T 4: 147,583,950 Q425L possibly damaging Het
Other mutations in Atp2c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00984:Atp2c1 APN 9 105418579 missense probably damaging 1.00
IGL01682:Atp2c1 APN 9 105452842 missense probably damaging 1.00
IGL01874:Atp2c1 APN 9 105448825 missense probably damaging 1.00
IGL02299:Atp2c1 APN 9 105461087 unclassified probably benign
IGL03186:Atp2c1 APN 9 105413130 missense probably benign 0.10
IGL03212:Atp2c1 APN 9 105445267 missense probably damaging 1.00
IGL02799:Atp2c1 UTSW 9 105413043 unclassified probably benign
IGL03047:Atp2c1 UTSW 9 105521007 intron probably benign
R0885:Atp2c1 UTSW 9 105421573 critical splice donor site probably null
R1072:Atp2c1 UTSW 9 105459744 missense possibly damaging 0.92
R1469:Atp2c1 UTSW 9 105435152 nonsense probably null
R1469:Atp2c1 UTSW 9 105435152 nonsense probably null
R1611:Atp2c1 UTSW 9 105442852 missense probably damaging 0.98
R1638:Atp2c1 UTSW 9 105432698 missense probably damaging 0.96
R1722:Atp2c1 UTSW 9 105439400 missense probably benign 0.01
R1734:Atp2c1 UTSW 9 105414655 missense probably damaging 1.00
R1782:Atp2c1 UTSW 9 105431587 missense probably damaging 0.99
R1964:Atp2c1 UTSW 9 105446123 missense probably damaging 1.00
R2008:Atp2c1 UTSW 9 105432726 missense probably benign 0.00
R2093:Atp2c1 UTSW 9 105418121 nonsense probably null
R3720:Atp2c1 UTSW 9 105422976 missense probably damaging 1.00
R4118:Atp2c1 UTSW 9 105466659 missense probably damaging 1.00
R4273:Atp2c1 UTSW 9 105435140 missense probably benign 0.10
R4763:Atp2c1 UTSW 9 105418567 missense probably damaging 1.00
R4962:Atp2c1 UTSW 9 105442950 missense probably benign 0.03
R5121:Atp2c1 UTSW 9 105448825 missense probably damaging 1.00
R5458:Atp2c1 UTSW 9 105414725 nonsense probably null
R5551:Atp2c1 UTSW 9 105459737 missense probably damaging 1.00
R6198:Atp2c1 UTSW 9 105521072 missense probably benign 0.00
R6414:Atp2c1 UTSW 9 105466656 missense probably damaging 1.00
R6432:Atp2c1 UTSW 9 105445313 missense probably damaging 1.00
R6675:Atp2c1 UTSW 9 105453533 critical splice donor site probably null
R6719:Atp2c1 UTSW 9 105424178 missense probably damaging 1.00
R6777:Atp2c1 UTSW 9 105418600 missense possibly damaging 0.64
R6847:Atp2c1 UTSW 9 105418579 missense probably damaging 1.00
R6870:Atp2c1 UTSW 9 105470062 missense probably benign 0.13
R7097:Atp2c1 UTSW 9 105464651 missense probably damaging 1.00
R7120:Atp2c1 UTSW 9 105420186 nonsense probably null
R7216:Atp2c1 UTSW 9 105467731 missense probably benign 0.00
R7284:Atp2c1 UTSW 9 105520809 intron probably null
R7365:Atp2c1 UTSW 9 105422999 missense probably damaging 1.00
R7448:Atp2c1 UTSW 9 105452783 missense probably damaging 0.98
R7818:Atp2c1 UTSW 9 105414757 missense probably benign 0.06
X0053:Atp2c1 UTSW 9 105418684 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAACAACACAGTTATACCGATGGCAA -3'
(R):5'- TCAAAGGGGCCTGTTCGCTTAAAT -3'

Sequencing Primer
(F):5'- ACCAGTTCTAGGAGGGTCAA -3'
(R):5'- AGTTCTTTGGCTCGCAGC -3'
Posted On2014-05-09