Incidental Mutation 'R1667:Ascl1'
ID187299
Institutional Source Beutler Lab
Gene Symbol Ascl1
Ensembl Gene ENSMUSG00000020052
Gene Nameachaete-scute family bHLH transcription factor 1
SynonymsMash1, ASH1, bHLHa46
MMRRC Submission 039703-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1667 (G1)
Quality Score94
Status Validated
Chromosome10
Chromosomal Location87490819-87493660 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87492793 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 99 (N99S)
Ref Sequence ENSEMBL: ENSMUSP00000020243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020243]
Predicted Effect probably benign
Transcript: ENSMUST00000020243
AA Change: N99S

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000020243
Gene: ENSMUSG00000020052
AA Change: N99S

DomainStartEndE-ValueType
low complexity region 11 60 N/A INTRINSIC
HLH 119 171 1.43e-19 SMART
Meta Mutation Damage Score 0.096 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the basic helix-loop-helix (BHLH) family of transcription factors. The protein activates transcription by binding to the E box (5'-CANNTG-3'). Dimerization with other BHLH proteins is required for efficient DNA binding. This protein plays a role in the neuronal commitment and differentiation and in the generation of olfactory and autonomic neurons. Mutations in this gene may contribute to the congenital central hypoventilation syndrome (CCHS) phenotype in rare cases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants show impaired development of olfactory, sympathetic, parasympathetic, and enteric ganglia, lung neuroendocrine and adrenal chromaffin cells, and various brain centers, and die at birth with feeding and breathing problems. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra1 G A 7: 139,845,648 A26T possibly damaging Het
Adgrg3 T A 8: 95,033,373 Y73* probably null Het
Alk A T 17: 71,911,567 V761E probably damaging Het
Ankrd13a T C 5: 114,786,733 V93A possibly damaging Het
Anks1b T C 10: 90,511,184 probably null Het
Atm A T 9: 53,500,932 L972Q probably damaging Het
Atp2c1 A T 9: 105,432,797 L566Q probably null Het
Bank1 T A 3: 136,093,296 Y629F probably damaging Het
Bod1l G T 5: 41,816,775 L2399I probably benign Het
Bub1b G A 2: 118,641,189 G1010D probably benign Het
Ces1b G A 8: 93,056,904 H563Y possibly damaging Het
Cfap70 T C 14: 20,404,157 E853G probably benign Het
Cfh T C 1: 140,105,523 E779G probably benign Het
Cox7c A G 13: 86,045,884 S7P probably benign Het
Cyp2c67 A G 19: 39,643,590 probably null Het
Dhx30 G T 9: 110,085,445 L995I possibly damaging Het
Dhx30 G C 9: 110,085,446 N957K possibly damaging Het
Dsc3 T C 18: 19,991,560 T36A possibly damaging Het
Dstyk A G 1: 132,456,919 D717G probably damaging Het
Dusp10 A G 1: 184,036,858 D7G probably damaging Het
E230001N04Rik T G 17: 28,523,961 noncoding transcript Het
Ece2 T C 16: 20,637,838 S330P possibly damaging Het
Fam172a T A 13: 77,759,516 M1K probably null Het
Frmd5 ATAGTGGAATTGTTCAAACTC ATAGTGGAATTGTTCAAACTCTAGTGGAATTGTTCAAACTC 2: 121,548,730 probably null Het
Gata3 T C 2: 9,877,549 H14R possibly damaging Het
Ggta1 T A 2: 35,414,283 I75F possibly damaging Het
Hcn1 A T 13: 117,603,073 I124F unknown Het
Herpud1 A C 8: 94,389,366 D53A probably damaging Het
Inhba T A 13: 16,026,624 L257Q possibly damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Jmy T A 13: 93,498,370 S313C probably damaging Het
Lpo G A 11: 87,807,241 probably benign Het
Lsg1 T C 16: 30,571,352 E315G probably damaging Het
Lsm14a T A 7: 34,365,654 T167S possibly damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Map3k2 T C 18: 32,203,792 probably benign Het
Mapk12 A T 15: 89,140,141 M81K probably damaging Het
Matn2 T A 15: 34,378,732 C305S probably damaging Het
Mgam T C 6: 40,677,044 Y844H possibly damaging Het
Mgat5b A G 11: 116,947,377 R281G probably benign Het
Mon1b T G 8: 113,641,957 C497G probably damaging Het
Mybbp1a A T 11: 72,445,217 H452L probably benign Het
Mybl2 A G 2: 163,075,696 T41A probably damaging Het
Ncoa5 A G 2: 165,001,703 V540A probably damaging Het
Nup93 T A 8: 94,292,687 V47E possibly damaging Het
Olfr1052 A G 2: 86,298,736 M307V probably null Het
Olfr17 A T 7: 107,097,770 M102L probably benign Het
Orc6 T A 8: 85,305,285 C100S possibly damaging Het
Otogl G T 10: 107,813,965 Y1176* probably null Het
Patj A T 4: 98,413,027 D183V probably damaging Het
Pik3r3 A G 4: 116,222,317 T4A probably damaging Het
Pla2g4d G A 2: 120,270,150 probably benign Het
Pla2r1 A G 2: 60,420,257 I1407T probably benign Het
Pramef12 A T 4: 144,393,036 C320* probably null Het
Prex2 A T 1: 11,186,757 H1231L probably benign Het
Prkca A G 11: 107,983,946 V390A probably damaging Het
Psmd13 T A 7: 140,890,609 W255R probably damaging Het
Rec8 T A 14: 55,618,796 N37K probably damaging Het
Rnf207 C T 4: 152,313,215 E361K probably benign Het
Serpina3f T A 12: 104,217,440 L187Q probably damaging Het
Skint11 A T 4: 114,194,781 T109S probably damaging Het
Slc7a8 A G 14: 54,724,849 S443P probably damaging Het
Slc8b1 T A 5: 120,521,082 F197Y probably benign Het
Sox2 T C 3: 34,650,419 Y2H probably damaging Het
Speg T A 1: 75,410,549 probably benign Het
Tlr3 T C 8: 45,400,837 N149D probably benign Het
Trim60 A C 8: 65,001,464 D44E probably benign Het
Ugt1a7c A G 1: 88,095,935 Y272C probably damaging Het
Vmn1r4 T A 6: 56,956,753 Y81N probably damaging Het
Vmn2r73 A T 7: 85,857,681 C808S probably benign Het
Ythdf3 T C 3: 16,204,892 I412T possibly damaging Het
Zfp672 T C 11: 58,316,095 T467A possibly damaging Het
Zfp985 A T 4: 147,583,950 Q425L possibly damaging Het
Other mutations in Ascl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3899:Ascl1 UTSW 10 87492573 missense probably benign 0.16
R5387:Ascl1 UTSW 10 87492689 missense probably damaging 1.00
R5436:Ascl1 UTSW 10 87492946 missense unknown
R6058:Ascl1 UTSW 10 87492700 missense probably damaging 1.00
R7297:Ascl1 UTSW 10 87492464 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACCCGCCATAGAGTTCAAGTCGT -3'
(R):5'- ACAGTTTGGCCCGGCATGGAGA -3'

Sequencing Primer
(F):5'- CCATAGAGTTCAAGTCGTTGGAG -3'
(R):5'- CTCTGGCAAGATGGAGAGTG -3'
Posted On2014-05-09