Mutagenetix > Incidental Mutations

Incidental Mutation 'R1667:Anks1b'

187300

Institutional Source

Beutler Lab

Gene Symbol

Anks1b

Ensembl Gene

ENSMUSG00000058589

Gene Name

ankyrin repeat and sterile alpha motif domain containing 1B

Synonyms

C030032C09Rik, AIDA-1b, LOC380650, Gm10937, E530015N03Rik

MMRRC Submission

039703-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1667 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

89873509-90973300 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 90511184 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000138539 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099368] [ENSMUST00000099368] [ENSMUST00000182907] [ENSMUST00000182936] [ENSMUST00000183156]

Predicted Effect

probably null
Transcript: ENSMUST00000099368

SMART Domains

Protein: ENSMUSP00000096968
Gene: ENSMUSG00000058589

Domain	Start	End	E-Value	Type
low complexity region	21	46	N/A	INTRINSIC
ANK	58	87	1.88e-5	SMART
ANK	91	123	3.13e-2	SMART
ANK	127	156	6.92e-4	SMART
ANK	160	189	3.08e-1	SMART
ANK	193	222	1.43e-5	SMART
ANK	225	254	4.75e-2	SMART
low complexity region	498	513	N/A	INTRINSIC
low complexity region	551	577	N/A	INTRINSIC
low complexity region	659	670	N/A	INTRINSIC
SAM	806	875	2.06e-19	SMART
SAM	880	931	4.44e-1	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000099368

SMART Domains

Protein: ENSMUSP00000096968
Gene: ENSMUSG00000058589

Domain	Start	End	E-Value	Type
low complexity region	21	46	N/A	INTRINSIC
ANK	58	87	1.88e-5	SMART
ANK	91	123	3.13e-2	SMART
ANK	127	156	6.92e-4	SMART
ANK	160	189	3.08e-1	SMART
ANK	193	222	1.43e-5	SMART
ANK	225	254	4.75e-2	SMART
low complexity region	498	513	N/A	INTRINSIC
low complexity region	551	577	N/A	INTRINSIC
low complexity region	659	670	N/A	INTRINSIC
SAM	806	875	2.06e-19	SMART
SAM	880	931	4.44e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000182907

SMART Domains

Protein: ENSMUSP00000138614
Gene: ENSMUSG00000058589

Domain	Start	End	E-Value	Type
low complexity region	21	45	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000182936

SMART Domains

Protein: ENSMUSP00000138209
Gene: ENSMUSG00000058589

Domain	Start	End	E-Value	Type
low complexity region	21	46	N/A	INTRINSIC
ANK	58	87	1.88e-5	SMART
ANK	91	123	3.13e-2	SMART
ANK	127	156	6.92e-4	SMART
ANK	160	189	3.08e-1	SMART
ANK	193	222	1.43e-5	SMART
ANK	225	254	5.03e2	SMART
low complexity region	464	479	N/A	INTRINSIC
low complexity region	517	543	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000183156

SMART Domains

Protein: ENSMUSP00000138539
Gene: ENSMUSG00000058589

Domain	Start	End	E-Value	Type
low complexity region	21	46	N/A	INTRINSIC
ANK	58	87	1.88e-5	SMART
ANK	91	123	3.13e-2	SMART
ANK	127	156	6.92e-4	SMART
ANK	160	189	3.08e-1	SMART
ANK	193	222	1.43e-5	SMART
ANK	225	254	4.75e-2	SMART
low complexity region	498	513	N/A	INTRINSIC
low complexity region	551	577	N/A	INTRINSIC
low complexity region	659	670	N/A	INTRINSIC
SAM	806	875	2.06e-19	SMART
SAM	880	948	5.66e-17	SMART
low complexity region	968	983	N/A	INTRINSIC
PTB	1056	1194	2.94e-38	SMART

Meta Mutation Damage Score

0.9495

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.0%

Validation Efficiency

99% (76/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein that is predominantly expressed in brain and testis. This protein interacts with amyloid beta protein precursor (AbetaPP) and may have a role in normal brain development, and in the pathogenesis of Alzheimer's disease. Expression of this gene has been shown to be elevated in patients with pre-B cell acute lymphocytic leukemia associated with t(1;19) translocation. Alternatively spliced transcript variants encoding different isoforms (some with different subcellular localization, PMID:15004329) have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a conditional allele activated in neurons alters hippocampal synaptic transmission. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgra1	G	A	7: 139,845,648	A26T	possibly damaging	Het
Adgrg3	T	A	8: 95,033,373	Y73*	probably null	Het
Alk	A	T	17: 71,911,567	V761E	probably damaging	Het
Ankrd13a	T	C	5: 114,786,733	V93A	possibly damaging	Het
Ascl1	T	C	10: 87,492,793	N99S	probably benign	Het
Atm	A	T	9: 53,500,932	L972Q	probably damaging	Het
Atp2c1	A	T	9: 105,432,797	L566Q	probably null	Het
Bank1	T	A	3: 136,093,296	Y629F	probably damaging	Het
Bod1l	G	T	5: 41,816,775	L2399I	probably benign	Het
Bub1b	G	A	2: 118,641,189	G1010D	probably benign	Het
Ces1b	G	A	8: 93,056,904	H563Y	possibly damaging	Het
Cfap70	T	C	14: 20,404,157	E853G	probably benign	Het
Cfh	T	C	1: 140,105,523	E779G	probably benign	Het
Cox7c	A	G	13: 86,045,884	S7P	probably benign	Het
Cyp2c67	A	G	19: 39,643,590		probably null	Het
Dhx30	G	T	9: 110,085,445	L995I	possibly damaging	Het
Dhx30	G	C	9: 110,085,446	N957K	possibly damaging	Het
Dsc3	T	C	18: 19,991,560	T36A	possibly damaging	Het
Dstyk	A	G	1: 132,456,919	D717G	probably damaging	Het
Dusp10	A	G	1: 184,036,858	D7G	probably damaging	Het
E230001N04Rik	T	G	17: 28,523,961		noncoding transcript	Het
Ece2	T	C	16: 20,637,838	S330P	possibly damaging	Het
Fam172a	T	A	13: 77,759,516	M1K	probably null	Het
Frmd5	ATAGTGGAATTGTTCAAACTC	ATAGTGGAATTGTTCAAACTCTAGTGGAATTGTTCAAACTC	2: 121,548,730		probably null	Het
Gata3	T	C	2: 9,877,549	H14R	possibly damaging	Het
Ggta1	T	A	2: 35,414,283	I75F	possibly damaging	Het
Hcn1	A	T	13: 117,603,073	I124F	unknown	Het
Herpud1	A	C	8: 94,389,366	D53A	probably damaging	Het
Inhba	T	A	13: 16,026,624	L257Q	possibly damaging	Het
Itga10	C	T	3: 96,651,738		probably benign	Het
Jmy	T	A	13: 93,498,370	S313C	probably damaging	Het
Lpo	G	A	11: 87,807,241		probably benign	Het
Lsg1	T	C	16: 30,571,352	E315G	probably damaging	Het
Lsm14a	T	A	7: 34,365,654	T167S	possibly damaging	Het
Lsmem1	GTACATACATACATACATACATACATACA	GTACATACATACATACATACATACATACATACA	12: 40,185,261		probably null	Het
Map3k2	T	C	18: 32,203,792		probably benign	Het
Mapk12	A	T	15: 89,140,141	M81K	probably damaging	Het
Matn2	T	A	15: 34,378,732	C305S	probably damaging	Het
Mgam	T	C	6: 40,677,044	Y844H	possibly damaging	Het
Mgat5b	A	G	11: 116,947,377	R281G	probably benign	Het
Mon1b	T	G	8: 113,641,957	C497G	probably damaging	Het
Mybbp1a	A	T	11: 72,445,217	H452L	probably benign	Het
Mybl2	A	G	2: 163,075,696	T41A	probably damaging	Het
Ncoa5	A	G	2: 165,001,703	V540A	probably damaging	Het
Nup93	T	A	8: 94,292,687	V47E	possibly damaging	Het
Olfr1052	A	G	2: 86,298,736	M307V	probably null	Het
Olfr17	A	T	7: 107,097,770	M102L	probably benign	Het
Orc6	T	A	8: 85,305,285	C100S	possibly damaging	Het
Otogl	G	T	10: 107,813,965	Y1176*	probably null	Het
Patj	A	T	4: 98,413,027	D183V	probably damaging	Het
Pik3r3	A	G	4: 116,222,317	T4A	probably damaging	Het
Pla2g4d	G	A	2: 120,270,150		probably benign	Het
Pla2r1	A	G	2: 60,420,257	I1407T	probably benign	Het
Pramef12	A	T	4: 144,393,036	C320*	probably null	Het
Prex2	A	T	1: 11,186,757	H1231L	probably benign	Het
Prkca	A	G	11: 107,983,946	V390A	probably damaging	Het
Psmd13	T	A	7: 140,890,609	W255R	probably damaging	Het
Rec8	T	A	14: 55,618,796	N37K	probably damaging	Het
Rnf207	C	T	4: 152,313,215	E361K	probably benign	Het
Serpina3f	T	A	12: 104,217,440	L187Q	probably damaging	Het
Skint11	A	T	4: 114,194,781	T109S	probably damaging	Het
Slc7a8	A	G	14: 54,724,849	S443P	probably damaging	Het
Slc8b1	T	A	5: 120,521,082	F197Y	probably benign	Het
Sox2	T	C	3: 34,650,419	Y2H	probably damaging	Het
Speg	T	A	1: 75,410,549		probably benign	Het
Tlr3	T	C	8: 45,400,837	N149D	probably benign	Het
Trim60	A	C	8: 65,001,464	D44E	probably benign	Het
Ugt1a7c	A	G	1: 88,095,935	Y272C	probably damaging	Het
Vmn1r4	T	A	6: 56,956,753	Y81N	probably damaging	Het
Vmn2r73	A	T	7: 85,857,681	C808S	probably benign	Het
Ythdf3	T	C	3: 16,204,892	I412T	possibly damaging	Het
Zfp672	T	C	11: 58,316,095	T467A	possibly damaging	Het
Zfp985	A	T	4: 147,583,950	Q425L	possibly damaging	Het

Other mutations in Anks1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01669:Anks1b	APN	10	90897238	splice site	probably benign
IGL01890:Anks1b	APN	10	90644527	missense	probably benign	0.15
IGL01966:Anks1b	APN	10	90895132	missense	probably damaging	1.00
IGL02176:Anks1b	APN	10	90042668	missense	probably damaging	0.99
IGL02205:Anks1b	APN	10	90071094	missense	probably benign	0.00
IGL02465:Anks1b	APN	10	90163265	nonsense	probably null
IGL02534:Anks1b	APN	10	90895117	missense	probably benign	0.45
IGL02554:Anks1b	APN	10	90921378	missense	probably damaging	1.00
IGL02820:Anks1b	APN	10	90077059	missense	possibly damaging	0.93
IGL03164:Anks1b	APN	10	90042692	missense	probably damaging	1.00
R0096:Anks1b	UTSW	10	90074062	missense	possibly damaging	0.90
R0482:Anks1b	UTSW	10	90359195	missense	probably benign	0.00
R0542:Anks1b	UTSW	10	90073967	splice site	probably benign
R0848:Anks1b	UTSW	10	90071125	missense	probably damaging	0.99
R1056:Anks1b	UTSW	10	90921429	splice site	probably null
R1398:Anks1b	UTSW	10	90050029	missense	probably damaging	1.00
R1446:Anks1b	UTSW	10	90511073	missense	probably benign	0.00
R1548:Anks1b	UTSW	10	90049985	missense	possibly damaging	0.79
R1551:Anks1b	UTSW	10	90076981	missense	probably benign	0.00
R1607:Anks1b	UTSW	10	90042548	missense	probably damaging	1.00
R1701:Anks1b	UTSW	10	90049954	missense	probably damaging	1.00
R1843:Anks1b	UTSW	10	90512889	critical splice donor site	probably null
R1899:Anks1b	UTSW	10	90260756	missense	probably damaging	1.00
R1957:Anks1b	UTSW	10	90049930	missense	probably damaging	1.00
R2036:Anks1b	UTSW	10	90969853	missense	probably damaging	0.99
R2279:Anks1b	UTSW	10	90050096	missense	probably damaging	1.00
R2280:Anks1b	UTSW	10	90966302	missense	probably damaging	1.00
R2937:Anks1b	UTSW	10	90077066	missense	probably damaging	1.00
R3739:Anks1b	UTSW	10	90033216	missense	probably damaging	1.00
R4061:Anks1b	UTSW	10	90307622	missense	probably damaging	0.98
R4459:Anks1b	UTSW	10	90510844	missense	probably damaging	1.00
R4479:Anks1b	UTSW	10	90049892	missense	probably damaging	1.00
R4510:Anks1b	UTSW	10	90510790	missense	probably benign	0.01
R4511:Anks1b	UTSW	10	90510790	missense	probably benign	0.01
R4780:Anks1b	UTSW	10	89873732	missense	probably damaging	1.00
R4785:Anks1b	UTSW	10	90914750	missense	probably null	0.88
R4790:Anks1b	UTSW	10	90163275	missense	probably damaging	0.99
R5012:Anks1b	UTSW	10	90359137	missense	probably benign	0.06
R5400:Anks1b	UTSW	10	90512824	missense	probably damaging	1.00
R5586:Anks1b	UTSW	10	90077064	missense	probably damaging	0.98
R5687:Anks1b	UTSW	10	90914711	missense	probably benign	0.03
R5899:Anks1b	UTSW	10	90923517	splice site	probably null
R5917:Anks1b	UTSW	10	90576941	intron	probably benign
R5999:Anks1b	UTSW	10	90359048	missense	probably damaging	1.00
R6080:Anks1b	UTSW	10	90966349	nonsense	probably null
R6216:Anks1b	UTSW	10	90260756	missense	probably damaging	1.00
R6265:Anks1b	UTSW	10	90941500	missense	probably damaging	1.00
R6298:Anks1b	UTSW	10	90680837	missense	probably damaging	1.00
R6337:Anks1b	UTSW	10	90921296	missense	probably benign	0.27
R6522:Anks1b	UTSW	10	90897327	intron	probably benign
R6843:Anks1b	UTSW	10	90948598	missense	probably damaging	1.00
R6852:Anks1b	UTSW	10	90260654	missense	probably damaging	1.00
R6933:Anks1b	UTSW	10	90069490	missense	probably damaging	1.00
R7114:Anks1b	UTSW	10	90307698	missense	probably damaging	1.00
R7211:Anks1b	UTSW	10	90511070	missense	possibly damaging	0.94
R7241:Anks1b	UTSW	10	90512837	missense	probably damaging	1.00
R7264:Anks1b	UTSW	10	90512870	missense	probably benign	0.08
R7325:Anks1b	UTSW	10	90941432	missense	probably damaging	1.00
R7392:Anks1b	UTSW	10	90680786	missense	possibly damaging	0.47
R7578:Anks1b	UTSW	10	90049927	missense	probably damaging	1.00
R7604:Anks1b	UTSW	10	90260846	splice site	probably null
R7633:Anks1b	UTSW	10	90948584	missense	probably damaging	1.00
R7881:Anks1b	UTSW	10	90967018	missense	probably benign	0.07
R7910:Anks1b	UTSW	10	90680792	missense	probably damaging	1.00
R7941:Anks1b	UTSW	10	90577155	missense	probably damaging	0.98
R8045:Anks1b	UTSW	10	90680860	missense	probably benign
R8146:Anks1b	UTSW	10	90307698	missense	probably damaging	1.00
R8176:Anks1b	UTSW	10	90069491	missense	probably damaging	1.00
R8535:Anks1b	UTSW	10	90948631	missense	probably benign	0.00
RF004:Anks1b	UTSW	10	90033225	missense	probably damaging	1.00
RF008:Anks1b	UTSW	10	90033225	missense	probably damaging	1.00
RF017:Anks1b	UTSW	10	90033225	missense	probably damaging	1.00
RF018:Anks1b	UTSW	10	90033225	missense	probably damaging	1.00
RF023:Anks1b	UTSW	10	90033225	missense	probably damaging	1.00
X0064:Anks1b	UTSW	10	90512845	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAACCATACCATCGTTGGCACAAG -3'
(R):5'- GTAGCAATGCGCTCATTTTCCCAC -3'

Sequencing Primer
(F):5'- TCGTTGGCACAAGAATGTCC -3'
(R):5'- TTATTAACAACGCCTACCCCTCC -3'

Posted On

2014-05-09