Incidental Mutation 'R1668:Nsmaf'
ID187344
Institutional Source Beutler Lab
Gene Symbol Nsmaf
Ensembl Gene ENSMUSG00000028245
Gene Nameneutral sphingomyelinase (N-SMase) activation associated factor
SynonymsFan, factor associated with N-SMase activation
MMRRC Submission 039704-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R1668 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location6396207-6454271 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6398880 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 795 (L795P)
Ref Sequence ENSEMBL: ENSMUSP00000029910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029910] [ENSMUST00000029912] [ENSMUST00000103008] [ENSMUST00000108374]
Predicted Effect probably damaging
Transcript: ENSMUST00000029910
AA Change: L795P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029910
Gene: ENSMUSG00000028245
AA Change: L795P

DomainStartEndE-ValueType
low complexity region 23 28 N/A INTRINSIC
GRAM 176 247 2.22e-11 SMART
Beach 302 575 6.28e-190 SMART
WD40 622 661 4.55e-3 SMART
WD40 664 703 2.97e0 SMART
WD40 706 743 1.47e-6 SMART
WD40 756 794 1.7e-2 SMART
WD40 797 836 1.02e-5 SMART
WD40 839 875 9.55e0 SMART
WD40 878 917 1.5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000029912
SMART Domains Protein: ENSMUSP00000029912
Gene: ENSMUSG00000028249

DomainStartEndE-ValueType
PDZ 124 195 7.09e-15 SMART
PDZ 208 274 6.04e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103008
SMART Domains Protein: ENSMUSP00000100073
Gene: ENSMUSG00000028249

DomainStartEndE-ValueType
PDZ 123 194 7.09e-15 SMART
PDZ 207 273 6.04e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108374
SMART Domains Protein: ENSMUSP00000104011
Gene: ENSMUSG00000028249

DomainStartEndE-ValueType
PDZ 124 195 2.84e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143704
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156715
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD-repeat protein that binds the cytoplasmic sphingomyelinase activation domain of the 55kD tumor necrosis factor receptor. This protein is required for TNF-mediated activation of neutral sphingomyelinase and may play a role in regulating TNF-induced cellular responses such as inflammation. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation show no gross phenotypic abnormalities but display delayed cutaneous barrier repair. In addition, D-galactosamine-sensitized homozygotes are partially resistant to LPS- and TNF-induced lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra2c T C 5: 35,280,297 S138P probably damaging Het
Appl1 A C 14: 26,923,854 S666R probably damaging Het
Arhgap45 A G 10: 80,028,750 S879G possibly damaging Het
Calcoco2 T C 11: 96,102,737 M140V probably benign Het
Cap2 C A 13: 46,615,323 H147N probably damaging Het
Chd9 A T 8: 91,041,186 H2437L probably damaging Het
Col5a3 A G 9: 20,771,096 I1684T unknown Het
Comp A T 8: 70,378,957 probably null Het
Cyp2c50 A T 19: 40,091,055 M198L probably benign Het
Dnaaf2 A G 12: 69,196,691 V532A probably benign Het
Dnah10 A T 5: 124,765,562 Q1358L probably benign Het
Dopey2 T A 16: 93,765,516 S832T probably damaging Het
Dus3l T G 17: 56,766,912 F162C possibly damaging Het
Epb41l4a A G 18: 33,921,909 L42P probably damaging Het
Ercc5 T A 1: 44,167,033 S369T probably benign Het
Fam205a1 G T 4: 42,848,424 T1244K probably damaging Het
Fbxl2 C T 9: 113,989,146 V211M probably benign Het
Fermt3 A G 19: 7,018,692 V45A probably damaging Het
Frs3 C A 17: 47,703,222 P280Q possibly damaging Het
Fxn A G 19: 24,262,013 Y172H probably damaging Het
Gabpa T C 16: 84,846,181 V122A probably damaging Het
Gsta4 A G 9: 78,204,288 T66A probably benign Het
Hsdl2 C T 4: 59,612,697 T296M probably damaging Het
Kank4 T C 4: 98,778,896 N438S probably damaging Het
Krt24 A G 11: 99,284,618 I197T probably benign Het
Lct T C 1: 128,287,722 probably null Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mc4r A G 18: 66,859,409 L211P probably damaging Het
Mfsd4b5 T C 10: 39,973,691 T111A probably damaging Het
Mgat5b T A 11: 116,983,648 N635K probably benign Het
Mms19 A T 19: 41,952,556 M443K possibly damaging Het
Morc2a G A 11: 3,675,885 V162M probably benign Het
Mroh5 T C 15: 73,787,905 N359S probably benign Het
Mroh9 T C 1: 163,024,592 I843V possibly damaging Het
Nbeal2 T C 9: 110,638,893 D436G probably damaging Het
Nbr1 A G 11: 101,569,766 D502G probably benign Het
Ngfr C T 11: 95,587,545 G5D probably damaging Het
Nlrc4 G A 17: 74,445,906 T494M probably damaging Het
Notch3 T A 17: 32,158,589 H171L probably damaging Het
Nup210 T C 6: 91,028,805 T616A possibly damaging Het
Olfr1467 A C 19: 13,364,870 M81L probably benign Het
Olfr347 T A 2: 36,735,192 Y290* probably null Het
Olfr975 C A 9: 39,950,169 V201L possibly damaging Het
Olfr995 T A 2: 85,438,876 Y94F probably benign Het
Osbpl5 T C 7: 143,709,039 H192R probably damaging Het
Parp2 G A 14: 50,820,856 R486Q probably benign Het
Pcgf6 G A 19: 47,040,105 A286V probably damaging Het
Pla2r1 T C 2: 60,428,646 T1133A probably damaging Het
Plekha2 T C 8: 25,072,054 N48S probably damaging Het
Pole T G 5: 110,297,369 S461A probably damaging Het
Ppfibp2 T C 7: 107,729,892 L536P probably damaging Het
Prkcz G T 4: 155,289,751 F69L probably damaging Het
Prkd1 G A 12: 50,394,926 H277Y probably damaging Het
Rab23 A T 1: 33,734,854 K132* probably null Het
Rbck1 T A 2: 152,316,899 S488C probably damaging Het
Rbl1 T C 2: 157,159,734 Y878C probably damaging Het
Rpn2 C T 2: 157,294,155 T161M possibly damaging Het
Rufy4 G A 1: 74,147,678 V542I probably benign Het
Serpinb3d A G 1: 107,080,751 V128A probably benign Het
Smarca2 A G 19: 26,647,034 I365V possibly damaging Het
Sptb A G 12: 76,621,169 V718A probably benign Het
Susd4 A G 1: 182,858,563 H226R probably benign Het
Tmem151b T C 17: 45,545,905 Y203C probably damaging Het
Tmppe T C 9: 114,404,900 V89A possibly damaging Het
Trappc6b A T 12: 59,048,121 probably null Het
Ube4b A T 4: 149,361,294 M433K probably benign Het
Vmn1r202 A T 13: 22,501,370 D292E possibly damaging Het
Vmn1r22 A G 6: 57,900,719 M91T probably benign Het
Vmn1r43 T C 6: 89,869,701 I268V probably benign Het
Vmn1r49 T A 6: 90,072,782 R79S probably benign Het
Vmn2r14 T A 5: 109,219,047 K436* probably null Het
Wdr72 A G 9: 74,210,162 S719G probably damaging Het
Zfp526 T C 7: 25,225,542 F409L probably benign Het
Zfp804b A C 5: 6,771,323 L580R possibly damaging Het
Zfp977 T C 7: 42,580,646 T152A probably benign Het
Zyx T A 6: 42,356,032 V372E possibly damaging Het
Other mutations in Nsmaf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00697:Nsmaf APN 4 6417163 critical splice donor site probably null
IGL00778:Nsmaf APN 4 6435056 critical splice donor site probably null
IGL01775:Nsmaf APN 4 6396791 missense possibly damaging 0.79
IGL02003:Nsmaf APN 4 6418522 missense probably benign 0.02
IGL02039:Nsmaf APN 4 6424995 splice site probably benign
IGL02085:Nsmaf APN 4 6398551 missense probably benign 0.21
IGL02252:Nsmaf APN 4 6398378 missense probably benign 0.00
IGL02655:Nsmaf APN 4 6424933 missense possibly damaging 0.94
R0023:Nsmaf UTSW 4 6408680 missense probably damaging 0.96
R0454:Nsmaf UTSW 4 6424874 splice site probably null
R0538:Nsmaf UTSW 4 6419930 splice site probably null
R0605:Nsmaf UTSW 4 6418470 critical splice donor site probably null
R1033:Nsmaf UTSW 4 6438054 missense probably damaging 1.00
R1472:Nsmaf UTSW 4 6423448 nonsense probably null
R1519:Nsmaf UTSW 4 6438062 missense probably benign 0.06
R1641:Nsmaf UTSW 4 6409884 missense probably benign 0.01
R2212:Nsmaf UTSW 4 6396732 missense probably damaging 0.99
R2351:Nsmaf UTSW 4 6437921 missense probably damaging 1.00
R3862:Nsmaf UTSW 4 6435064 missense probably benign 0.00
R4112:Nsmaf UTSW 4 6417188 nonsense probably null
R4644:Nsmaf UTSW 4 6419940 splice site probably benign
R4807:Nsmaf UTSW 4 6398542 splice site probably null
R4960:Nsmaf UTSW 4 6423342 missense probably damaging 1.00
R5556:Nsmaf UTSW 4 6398621 missense probably benign 0.00
R5936:Nsmaf UTSW 4 6421017 intron probably benign
R7288:Nsmaf UTSW 4 6416641 missense probably benign
R7295:Nsmaf UTSW 4 6438083 missense probably benign 0.00
R7378:Nsmaf UTSW 4 6416586 missense probably benign
R7615:Nsmaf UTSW 4 6408563 missense probably damaging 1.00
X0021:Nsmaf UTSW 4 6398543 critical splice donor site probably null
X0063:Nsmaf UTSW 4 6414962 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATCTGCCAGAAAGACACACATGGAG -3'
(R):5'- CACATTAGCTGTACCAGCACATTGC -3'

Sequencing Primer
(F):5'- AGCTGCTTCAGAAAGTGCC -3'
(R):5'- CTGTACCAGCACATTGCATAGTAG -3'
Posted On2014-05-09