Incidental Mutation 'R1668:Ube4b'
ID187348
Institutional Source Beutler Lab
Gene Symbol Ube4b
Ensembl Gene ENSMUSG00000028960
Gene Nameubiquitination factor E4B
SynonymsUFD2a, 4930551I19Rik, Ufd2p, 4933406G05Rik, UFD2, D4Bwg0973e
MMRRC Submission 039704-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1668 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location149328416-149426749 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 149361294 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 433 (M433K)
Ref Sequence ENSEMBL: ENSMUSP00000099501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103212] [ENSMUST00000172836] [ENSMUST00000174343]
PDB Structure
U-box domain of the E3 Ubiquitin Ligase E4B [SOLUTION NMR]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000084123
Predicted Effect probably benign
Transcript: ENSMUST00000103212
AA Change: M433K

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000099501
Gene: ENSMUSG00000028960
AA Change: M433K

DomainStartEndE-ValueType
low complexity region 10 20 N/A INTRINSIC
low complexity region 21 33 N/A INTRINSIC
low complexity region 37 50 N/A INTRINSIC
low complexity region 76 99 N/A INTRINSIC
low complexity region 261 278 N/A INTRINSIC
low complexity region 439 452 N/A INTRINSIC
Pfam:Ufd2P_core 462 1083 1.3e-199 PFAM
Ubox 1102 1164 3.94e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141259
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151896
Predicted Effect probably benign
Transcript: ENSMUST00000172836
AA Change: M433K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000134452
Gene: ENSMUSG00000028960
AA Change: M433K

DomainStartEndE-ValueType
low complexity region 10 20 N/A INTRINSIC
low complexity region 21 33 N/A INTRINSIC
low complexity region 37 50 N/A INTRINSIC
low complexity region 76 99 N/A INTRINSIC
low complexity region 261 278 N/A INTRINSIC
low complexity region 439 452 N/A INTRINSIC
Pfam:Ufd2P_core 462 983 7.4e-143 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000174343
AA Change: C395S
SMART Domains Protein: ENSMUSP00000134556
Gene: ENSMUSG00000028960
AA Change: C395S

DomainStartEndE-ValueType
low complexity region 10 20 N/A INTRINSIC
low complexity region 21 33 N/A INTRINSIC
low complexity region 37 50 N/A INTRINSIC
low complexity region 76 99 N/A INTRINSIC
low complexity region 261 278 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes an additional conjugation factor, E4, which is involved in multiubiquitin chain assembly. This gene is also the strongest candidate in the neuroblastoma tumor suppressor genes. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene die by midgestation and exhibit cardiac development defects such as hemorrhage and cardiomyocyte apoptosis. Heterozygous mice exhibit axonal dystrophy in the nucleus gracilis, degeneration of Purkinje cells and gait abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra2c T C 5: 35,280,297 S138P probably damaging Het
Appl1 A C 14: 26,923,854 S666R probably damaging Het
Arhgap45 A G 10: 80,028,750 S879G possibly damaging Het
Calcoco2 T C 11: 96,102,737 M140V probably benign Het
Cap2 C A 13: 46,615,323 H147N probably damaging Het
Chd9 A T 8: 91,041,186 H2437L probably damaging Het
Col5a3 A G 9: 20,771,096 I1684T unknown Het
Comp A T 8: 70,378,957 probably null Het
Cyp2c50 A T 19: 40,091,055 M198L probably benign Het
Dnaaf2 A G 12: 69,196,691 V532A probably benign Het
Dnah10 A T 5: 124,765,562 Q1358L probably benign Het
Dopey2 T A 16: 93,765,516 S832T probably damaging Het
Dus3l T G 17: 56,766,912 F162C possibly damaging Het
Epb41l4a A G 18: 33,921,909 L42P probably damaging Het
Ercc5 T A 1: 44,167,033 S369T probably benign Het
Fam205a1 G T 4: 42,848,424 T1244K probably damaging Het
Fbxl2 C T 9: 113,989,146 V211M probably benign Het
Fermt3 A G 19: 7,018,692 V45A probably damaging Het
Frs3 C A 17: 47,703,222 P280Q possibly damaging Het
Fxn A G 19: 24,262,013 Y172H probably damaging Het
Gabpa T C 16: 84,846,181 V122A probably damaging Het
Gsta4 A G 9: 78,204,288 T66A probably benign Het
Hsdl2 C T 4: 59,612,697 T296M probably damaging Het
Kank4 T C 4: 98,778,896 N438S probably damaging Het
Krt24 A G 11: 99,284,618 I197T probably benign Het
Lct T C 1: 128,287,722 probably null Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mc4r A G 18: 66,859,409 L211P probably damaging Het
Mfsd4b5 T C 10: 39,973,691 T111A probably damaging Het
Mgat5b T A 11: 116,983,648 N635K probably benign Het
Mms19 A T 19: 41,952,556 M443K possibly damaging Het
Morc2a G A 11: 3,675,885 V162M probably benign Het
Mroh5 T C 15: 73,787,905 N359S probably benign Het
Mroh9 T C 1: 163,024,592 I843V possibly damaging Het
Nbeal2 T C 9: 110,638,893 D436G probably damaging Het
Nbr1 A G 11: 101,569,766 D502G probably benign Het
Ngfr C T 11: 95,587,545 G5D probably damaging Het
Nlrc4 G A 17: 74,445,906 T494M probably damaging Het
Notch3 T A 17: 32,158,589 H171L probably damaging Het
Nsmaf A G 4: 6,398,880 L795P probably damaging Het
Nup210 T C 6: 91,028,805 T616A possibly damaging Het
Olfr1467 A C 19: 13,364,870 M81L probably benign Het
Olfr347 T A 2: 36,735,192 Y290* probably null Het
Olfr975 C A 9: 39,950,169 V201L possibly damaging Het
Olfr995 T A 2: 85,438,876 Y94F probably benign Het
Osbpl5 T C 7: 143,709,039 H192R probably damaging Het
Parp2 G A 14: 50,820,856 R486Q probably benign Het
Pcgf6 G A 19: 47,040,105 A286V probably damaging Het
Pla2r1 T C 2: 60,428,646 T1133A probably damaging Het
Plekha2 T C 8: 25,072,054 N48S probably damaging Het
Pole T G 5: 110,297,369 S461A probably damaging Het
Ppfibp2 T C 7: 107,729,892 L536P probably damaging Het
Prkcz G T 4: 155,289,751 F69L probably damaging Het
Prkd1 G A 12: 50,394,926 H277Y probably damaging Het
Rab23 A T 1: 33,734,854 K132* probably null Het
Rbck1 T A 2: 152,316,899 S488C probably damaging Het
Rbl1 T C 2: 157,159,734 Y878C probably damaging Het
Rpn2 C T 2: 157,294,155 T161M possibly damaging Het
Rufy4 G A 1: 74,147,678 V542I probably benign Het
Serpinb3d A G 1: 107,080,751 V128A probably benign Het
Smarca2 A G 19: 26,647,034 I365V possibly damaging Het
Sptb A G 12: 76,621,169 V718A probably benign Het
Susd4 A G 1: 182,858,563 H226R probably benign Het
Tmem151b T C 17: 45,545,905 Y203C probably damaging Het
Tmppe T C 9: 114,404,900 V89A possibly damaging Het
Trappc6b A T 12: 59,048,121 probably null Het
Vmn1r202 A T 13: 22,501,370 D292E possibly damaging Het
Vmn1r22 A G 6: 57,900,719 M91T probably benign Het
Vmn1r43 T C 6: 89,869,701 I268V probably benign Het
Vmn1r49 T A 6: 90,072,782 R79S probably benign Het
Vmn2r14 T A 5: 109,219,047 K436* probably null Het
Wdr72 A G 9: 74,210,162 S719G probably damaging Het
Zfp526 T C 7: 25,225,542 F409L probably benign Het
Zfp804b A C 5: 6,771,323 L580R possibly damaging Het
Zfp977 T C 7: 42,580,646 T152A probably benign Het
Zyx T A 6: 42,356,032 V372E possibly damaging Het
Other mutations in Ube4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Ube4b APN 4 149381366 missense probably benign 0.29
IGL00820:Ube4b APN 4 149352921 splice site probably benign
IGL01093:Ube4b APN 4 149330269 missense probably benign 0.01
IGL01154:Ube4b APN 4 149365470 missense probably benign 0.28
IGL01612:Ube4b APN 4 149383818 missense probably damaging 0.98
IGL01800:Ube4b APN 4 149331494 missense probably damaging 1.00
IGL02149:Ube4b APN 4 149398684 missense possibly damaging 0.88
IGL02472:Ube4b APN 4 149387079 critical splice donor site probably null
IGL02839:Ube4b APN 4 149368399 missense probably damaging 0.98
IGL03027:Ube4b APN 4 149381277 missense probably damaging 1.00
R0143:Ube4b UTSW 4 149355457 missense possibly damaging 0.61
R0164:Ube4b UTSW 4 149360324 missense probably damaging 0.98
R0164:Ube4b UTSW 4 149360324 missense probably damaging 0.98
R0206:Ube4b UTSW 4 149398637 missense probably benign 0.38
R0591:Ube4b UTSW 4 149357577 intron probably benign
R1366:Ube4b UTSW 4 149335149 missense probably damaging 0.98
R1452:Ube4b UTSW 4 149371169 missense probably damaging 1.00
R1513:Ube4b UTSW 4 149351578 missense probably benign 0.17
R1874:Ube4b UTSW 4 149347971 missense probably damaging 1.00
R2002:Ube4b UTSW 4 149383797 missense probably benign 0.16
R2050:Ube4b UTSW 4 149344612 missense probably damaging 1.00
R2109:Ube4b UTSW 4 149372841 missense probably benign 0.00
R2281:Ube4b UTSW 4 149344572 missense probably damaging 1.00
R3547:Ube4b UTSW 4 149335116 missense probably damaging 1.00
R3881:Ube4b UTSW 4 149365404 intron probably null
R4378:Ube4b UTSW 4 149383798 missense probably damaging 1.00
R4563:Ube4b UTSW 4 149359165 intron probably benign
R4674:Ube4b UTSW 4 149331370 missense possibly damaging 0.86
R4716:Ube4b UTSW 4 149344612 missense probably damaging 1.00
R5026:Ube4b UTSW 4 149360565 missense probably damaging 1.00
R5125:Ube4b UTSW 4 149342992 missense probably damaging 1.00
R5178:Ube4b UTSW 4 149342992 missense probably damaging 1.00
R5182:Ube4b UTSW 4 149381242 missense probably null 0.08
R5229:Ube4b UTSW 4 149387178 missense probably damaging 1.00
R5303:Ube4b UTSW 4 149383803 missense probably damaging 0.98
R5346:Ube4b UTSW 4 149337424 missense possibly damaging 0.91
R5780:Ube4b UTSW 4 149331364 missense probably benign 0.00
R5813:Ube4b UTSW 4 149337468 missense probably damaging 1.00
R5842:Ube4b UTSW 4 149331430 missense probably benign 0.01
R5994:Ube4b UTSW 4 149372932 missense probably damaging 0.97
R6020:Ube4b UTSW 4 149368311 missense probably benign 0.17
R6125:Ube4b UTSW 4 149398746 missense probably benign 0.13
R6272:Ube4b UTSW 4 149387133 missense probably damaging 1.00
R6333:Ube4b UTSW 4 149348037 missense probably damaging 1.00
R6426:Ube4b UTSW 4 149425996 unclassified probably benign
R7203:Ube4b UTSW 4 149398610 missense probably benign 0.30
R7341:Ube4b UTSW 4 149343001 missense probably damaging 1.00
R7672:Ube4b UTSW 4 149387204 missense probably benign 0.10
R7713:Ube4b UTSW 4 149398781 missense possibly damaging 0.53
Z1088:Ube4b UTSW 4 149335125 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GTCTCCTCAAACCAGTAACTCTGCC -3'
(R):5'- AGCTTTGCCAAGCATTTGCAGTG -3'

Sequencing Primer
(F):5'- CAGGTCAGCAACCTATTCTGATG -3'
(R):5'- GGGAATGAAAGCTGTTCCTTGC -3'
Posted On2014-05-09