Incidental Mutation 'R1668:Plekha2'
ID187369
Institutional Source Beutler Lab
Gene Symbol Plekha2
Ensembl Gene ENSMUSG00000031557
Gene Namepleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 2
Synonyms6430512N22Rik, TAPP2
MMRRC Submission 039704-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1668 (G1)
Quality Score200
Status Not validated
Chromosome8
Chromosomal Location25039144-25102376 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25072054 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 48 (N48S)
Ref Sequence ENSEMBL: ENSMUSP00000122564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064883] [ENSMUST00000098866] [ENSMUST00000125466] [ENSMUST00000128715]
Predicted Effect probably damaging
Transcript: ENSMUST00000064883
AA Change: N48S

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000066546
Gene: ENSMUSG00000031557
AA Change: N48S

DomainStartEndE-ValueType
PH 8 115 3.11e-10 SMART
PH 199 300 1.91e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098866
AA Change: N48S

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000096464
Gene: ENSMUSG00000031557
AA Change: N48S

DomainStartEndE-ValueType
PH 8 115 3.11e-10 SMART
PH 199 300 1.91e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000125466
AA Change: N48S

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000116764
Gene: ENSMUSG00000031557
AA Change: N48S

DomainStartEndE-ValueType
PDB:1V5P|A 1 95 4e-68 PDB
Blast:PH 8 95 9e-61 BLAST
SCOP:d1eaza_ 11 95 1e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000128715
AA Change: N48S

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122564
Gene: ENSMUSG00000031557
AA Change: N48S

DomainStartEndE-ValueType
PH 8 115 3.11e-10 SMART
PH 199 300 1.91e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211708
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-in allele are viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra2c T C 5: 35,280,297 S138P probably damaging Het
Appl1 A C 14: 26,923,854 S666R probably damaging Het
Arhgap45 A G 10: 80,028,750 S879G possibly damaging Het
Calcoco2 T C 11: 96,102,737 M140V probably benign Het
Cap2 C A 13: 46,615,323 H147N probably damaging Het
Chd9 A T 8: 91,041,186 H2437L probably damaging Het
Col5a3 A G 9: 20,771,096 I1684T unknown Het
Comp A T 8: 70,378,957 probably null Het
Cyp2c50 A T 19: 40,091,055 M198L probably benign Het
Dnaaf2 A G 12: 69,196,691 V532A probably benign Het
Dnah10 A T 5: 124,765,562 Q1358L probably benign Het
Dopey2 T A 16: 93,765,516 S832T probably damaging Het
Dus3l T G 17: 56,766,912 F162C possibly damaging Het
Epb41l4a A G 18: 33,921,909 L42P probably damaging Het
Ercc5 T A 1: 44,167,033 S369T probably benign Het
Fam205a1 G T 4: 42,848,424 T1244K probably damaging Het
Fbxl2 C T 9: 113,989,146 V211M probably benign Het
Fermt3 A G 19: 7,018,692 V45A probably damaging Het
Frs3 C A 17: 47,703,222 P280Q possibly damaging Het
Fxn A G 19: 24,262,013 Y172H probably damaging Het
Gabpa T C 16: 84,846,181 V122A probably damaging Het
Gsta4 A G 9: 78,204,288 T66A probably benign Het
Hsdl2 C T 4: 59,612,697 T296M probably damaging Het
Kank4 T C 4: 98,778,896 N438S probably damaging Het
Krt24 A G 11: 99,284,618 I197T probably benign Het
Lct T C 1: 128,287,722 probably null Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mc4r A G 18: 66,859,409 L211P probably damaging Het
Mfsd4b5 T C 10: 39,973,691 T111A probably damaging Het
Mgat5b T A 11: 116,983,648 N635K probably benign Het
Mms19 A T 19: 41,952,556 M443K possibly damaging Het
Morc2a G A 11: 3,675,885 V162M probably benign Het
Mroh5 T C 15: 73,787,905 N359S probably benign Het
Mroh9 T C 1: 163,024,592 I843V possibly damaging Het
Nbeal2 T C 9: 110,638,893 D436G probably damaging Het
Nbr1 A G 11: 101,569,766 D502G probably benign Het
Ngfr C T 11: 95,587,545 G5D probably damaging Het
Nlrc4 G A 17: 74,445,906 T494M probably damaging Het
Notch3 T A 17: 32,158,589 H171L probably damaging Het
Nsmaf A G 4: 6,398,880 L795P probably damaging Het
Nup210 T C 6: 91,028,805 T616A possibly damaging Het
Olfr1467 A C 19: 13,364,870 M81L probably benign Het
Olfr347 T A 2: 36,735,192 Y290* probably null Het
Olfr975 C A 9: 39,950,169 V201L possibly damaging Het
Olfr995 T A 2: 85,438,876 Y94F probably benign Het
Osbpl5 T C 7: 143,709,039 H192R probably damaging Het
Parp2 G A 14: 50,820,856 R486Q probably benign Het
Pcgf6 G A 19: 47,040,105 A286V probably damaging Het
Pla2r1 T C 2: 60,428,646 T1133A probably damaging Het
Pole T G 5: 110,297,369 S461A probably damaging Het
Ppfibp2 T C 7: 107,729,892 L536P probably damaging Het
Prkcz G T 4: 155,289,751 F69L probably damaging Het
Prkd1 G A 12: 50,394,926 H277Y probably damaging Het
Rab23 A T 1: 33,734,854 K132* probably null Het
Rbck1 T A 2: 152,316,899 S488C probably damaging Het
Rbl1 T C 2: 157,159,734 Y878C probably damaging Het
Rpn2 C T 2: 157,294,155 T161M possibly damaging Het
Rufy4 G A 1: 74,147,678 V542I probably benign Het
Serpinb3d A G 1: 107,080,751 V128A probably benign Het
Smarca2 A G 19: 26,647,034 I365V possibly damaging Het
Sptb A G 12: 76,621,169 V718A probably benign Het
Susd4 A G 1: 182,858,563 H226R probably benign Het
Tmem151b T C 17: 45,545,905 Y203C probably damaging Het
Tmppe T C 9: 114,404,900 V89A possibly damaging Het
Trappc6b A T 12: 59,048,121 probably null Het
Ube4b A T 4: 149,361,294 M433K probably benign Het
Vmn1r202 A T 13: 22,501,370 D292E possibly damaging Het
Vmn1r22 A G 6: 57,900,719 M91T probably benign Het
Vmn1r43 T C 6: 89,869,701 I268V probably benign Het
Vmn1r49 T A 6: 90,072,782 R79S probably benign Het
Vmn2r14 T A 5: 109,219,047 K436* probably null Het
Wdr72 A G 9: 74,210,162 S719G probably damaging Het
Zfp526 T C 7: 25,225,542 F409L probably benign Het
Zfp804b A C 5: 6,771,323 L580R possibly damaging Het
Zfp977 T C 7: 42,580,646 T152A probably benign Het
Zyx T A 6: 42,356,032 V372E possibly damaging Het
Other mutations in Plekha2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Plekha2 APN 8 25057327 missense probably damaging 0.98
IGL02123:Plekha2 APN 8 25042729 missense probably damaging 1.00
Byzantine UTSW 8 25088395 missense probably damaging 1.00
Elaborate UTSW 8 25043047 splice site probably null
R1178:Plekha2 UTSW 8 25059202 missense probably benign 0.26
R1181:Plekha2 UTSW 8 25059202 missense probably benign 0.26
R1722:Plekha2 UTSW 8 25042960 missense probably benign 0.02
R2153:Plekha2 UTSW 8 25088397 missense probably damaging 1.00
R4223:Plekha2 UTSW 8 25043020 missense probably damaging 1.00
R4585:Plekha2 UTSW 8 25043669 nonsense probably null
R4604:Plekha2 UTSW 8 25059835 missense probably null 1.00
R4791:Plekha2 UTSW 8 25042762 missense probably damaging 1.00
R4817:Plekha2 UTSW 8 25059944 missense possibly damaging 0.94
R5344:Plekha2 UTSW 8 25043047 splice site probably null
R5670:Plekha2 UTSW 8 25059238 missense probably benign 0.03
R5892:Plekha2 UTSW 8 25052365 missense probably benign
R6440:Plekha2 UTSW 8 25088397 missense probably damaging 1.00
R6970:Plekha2 UTSW 8 25059264 missense probably benign 0.00
R7157:Plekha2 UTSW 8 25063941 missense probably damaging 1.00
R7242:Plekha2 UTSW 8 25088395 missense probably damaging 1.00
R7674:Plekha2 UTSW 8 25057298 missense probably damaging 1.00
R7810:Plekha2 UTSW 8 25088340 critical splice donor site probably null
X0027:Plekha2 UTSW 8 25057303 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGGCTCACACCTCCAGGATGTAG -3'
(R):5'- TAAGGGCATCCCAGATCACAGCAG -3'

Sequencing Primer
(F):5'- CAGGATGTAGAGCTTCCTCATGC -3'
(R):5'- CTGTCCTAGAGTAACTCATCGGAAG -3'
Posted On2014-05-09