Incidental Mutation 'R1668:Ngfr'
ID187387
Institutional Source Beutler Lab
Gene Symbol Ngfr
Ensembl Gene ENSMUSG00000000120
Gene Namenerve growth factor receptor (TNFR superfamily, member 16)
Synonymsp75NGFR, p75NTR, p75, p75 neurotrophin receptor, LNGFR, Tnfrsf16
MMRRC Submission 039704-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.720) question?
Stock #R1668 (G1)
Quality Score109
Status Not validated
Chromosome11
Chromosomal Location95568818-95587735 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 95587545 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 5 (G5D)
Ref Sequence ENSEMBL: ENSMUSP00000000122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000122]
Predicted Effect probably damaging
Transcript: ENSMUST00000000122
AA Change: G5D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000000122
Gene: ENSMUSG00000000120
AA Change: G5D

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
TNFR 35 67 1.51e-4 SMART
TNFR 70 110 1.54e-5 SMART
TNFR 112 149 1.79e-6 SMART
TNFR 152 191 2.84e-9 SMART
transmembrane domain 253 275 N/A INTRINSIC
DEATH 336 421 2.98e-21 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nerve growth factor receptor contains an extracellular domain containing four 40-amino acid repeats with 6 cysteine residues at conserved positions followed by a serine/threonine-rich region, a single transmembrane domain, and a 155-amino acid cytoplasmic domain. The cysteine-rich region contains the nerve growth factor binding domain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations exhibit increased perinatal lethality, skin abnormalities, growth retardation, reduced sensory nerve innervation, elevated pain threshold, ataxia, reduced sciatic nerve diameter, and blood vessel abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra2c T C 5: 35,280,297 S138P probably damaging Het
Appl1 A C 14: 26,923,854 S666R probably damaging Het
Arhgap45 A G 10: 80,028,750 S879G possibly damaging Het
Calcoco2 T C 11: 96,102,737 M140V probably benign Het
Cap2 C A 13: 46,615,323 H147N probably damaging Het
Chd9 A T 8: 91,041,186 H2437L probably damaging Het
Col5a3 A G 9: 20,771,096 I1684T unknown Het
Comp A T 8: 70,378,957 probably null Het
Cyp2c50 A T 19: 40,091,055 M198L probably benign Het
Dnaaf2 A G 12: 69,196,691 V532A probably benign Het
Dnah10 A T 5: 124,765,562 Q1358L probably benign Het
Dopey2 T A 16: 93,765,516 S832T probably damaging Het
Dus3l T G 17: 56,766,912 F162C possibly damaging Het
Epb41l4a A G 18: 33,921,909 L42P probably damaging Het
Ercc5 T A 1: 44,167,033 S369T probably benign Het
Fam205a1 G T 4: 42,848,424 T1244K probably damaging Het
Fbxl2 C T 9: 113,989,146 V211M probably benign Het
Fermt3 A G 19: 7,018,692 V45A probably damaging Het
Frs3 C A 17: 47,703,222 P280Q possibly damaging Het
Fxn A G 19: 24,262,013 Y172H probably damaging Het
Gabpa T C 16: 84,846,181 V122A probably damaging Het
Gsta4 A G 9: 78,204,288 T66A probably benign Het
Hsdl2 C T 4: 59,612,697 T296M probably damaging Het
Kank4 T C 4: 98,778,896 N438S probably damaging Het
Krt24 A G 11: 99,284,618 I197T probably benign Het
Lct T C 1: 128,287,722 probably null Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mc4r A G 18: 66,859,409 L211P probably damaging Het
Mfsd4b5 T C 10: 39,973,691 T111A probably damaging Het
Mgat5b T A 11: 116,983,648 N635K probably benign Het
Mms19 A T 19: 41,952,556 M443K possibly damaging Het
Morc2a G A 11: 3,675,885 V162M probably benign Het
Mroh5 T C 15: 73,787,905 N359S probably benign Het
Mroh9 T C 1: 163,024,592 I843V possibly damaging Het
Nbeal2 T C 9: 110,638,893 D436G probably damaging Het
Nbr1 A G 11: 101,569,766 D502G probably benign Het
Nlrc4 G A 17: 74,445,906 T494M probably damaging Het
Notch3 T A 17: 32,158,589 H171L probably damaging Het
Nsmaf A G 4: 6,398,880 L795P probably damaging Het
Nup210 T C 6: 91,028,805 T616A possibly damaging Het
Olfr1467 A C 19: 13,364,870 M81L probably benign Het
Olfr347 T A 2: 36,735,192 Y290* probably null Het
Olfr975 C A 9: 39,950,169 V201L possibly damaging Het
Olfr995 T A 2: 85,438,876 Y94F probably benign Het
Osbpl5 T C 7: 143,709,039 H192R probably damaging Het
Parp2 G A 14: 50,820,856 R486Q probably benign Het
Pcgf6 G A 19: 47,040,105 A286V probably damaging Het
Pla2r1 T C 2: 60,428,646 T1133A probably damaging Het
Plekha2 T C 8: 25,072,054 N48S probably damaging Het
Pole T G 5: 110,297,369 S461A probably damaging Het
Ppfibp2 T C 7: 107,729,892 L536P probably damaging Het
Prkcz G T 4: 155,289,751 F69L probably damaging Het
Prkd1 G A 12: 50,394,926 H277Y probably damaging Het
Rab23 A T 1: 33,734,854 K132* probably null Het
Rbck1 T A 2: 152,316,899 S488C probably damaging Het
Rbl1 T C 2: 157,159,734 Y878C probably damaging Het
Rpn2 C T 2: 157,294,155 T161M possibly damaging Het
Rufy4 G A 1: 74,147,678 V542I probably benign Het
Serpinb3d A G 1: 107,080,751 V128A probably benign Het
Smarca2 A G 19: 26,647,034 I365V possibly damaging Het
Sptb A G 12: 76,621,169 V718A probably benign Het
Susd4 A G 1: 182,858,563 H226R probably benign Het
Tmem151b T C 17: 45,545,905 Y203C probably damaging Het
Tmppe T C 9: 114,404,900 V89A possibly damaging Het
Trappc6b A T 12: 59,048,121 probably null Het
Ube4b A T 4: 149,361,294 M433K probably benign Het
Vmn1r202 A T 13: 22,501,370 D292E possibly damaging Het
Vmn1r22 A G 6: 57,900,719 M91T probably benign Het
Vmn1r43 T C 6: 89,869,701 I268V probably benign Het
Vmn1r49 T A 6: 90,072,782 R79S probably benign Het
Vmn2r14 T A 5: 109,219,047 K436* probably null Het
Wdr72 A G 9: 74,210,162 S719G probably damaging Het
Zfp526 T C 7: 25,225,542 F409L probably benign Het
Zfp804b A C 5: 6,771,323 L580R possibly damaging Het
Zfp977 T C 7: 42,580,646 T152A probably benign Het
Zyx T A 6: 42,356,032 V372E possibly damaging Het
Other mutations in Ngfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02792:Ngfr APN 11 95571861 missense probably damaging 1.00
R0211:Ngfr UTSW 11 95571912 missense probably damaging 1.00
R0715:Ngfr UTSW 11 95574239 missense possibly damaging 0.62
R2298:Ngfr UTSW 11 95587490 small deletion probably benign
R5194:Ngfr UTSW 11 95580982 missense probably benign 0.06
R6053:Ngfr UTSW 11 95571006 missense possibly damaging 0.57
R6109:Ngfr UTSW 11 95578057 missense probably damaging 1.00
R6190:Ngfr UTSW 11 95574441 missense probably benign 0.00
R7276:Ngfr UTSW 11 95574344 missense probably benign 0.12
R7366:Ngfr UTSW 11 95574429 missense possibly damaging 0.84
R7567:Ngfr UTSW 11 95574321 missense probably benign
RF014:Ngfr UTSW 11 95578201 missense probably damaging 1.00
RF041:Ngfr UTSW 11 95587511 small deletion probably benign
RF056:Ngfr UTSW 11 95587511 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TTGCCAGCATCTGGGACCTTAAC -3'
(R):5'- GGCTTCATCAGTAGGAGAGCAATGG -3'

Sequencing Primer
(F):5'- TGGGACCTTAACGTCTTATTCTG -3'
(R):5'- GATCCGAAGCATCTTATGCTCAG -3'
Posted On2014-05-09