Incidental Mutation 'R1668:Mgat5b'
ID187391
Institutional Source Beutler Lab
Gene Symbol Mgat5b
Ensembl Gene ENSMUSG00000043857
Gene Namemannoside acetylglucosaminyltransferase 5, isoenzyme B
SynonymsGnT-IX
MMRRC Submission 039704-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R1668 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location116918863-116986948 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116983648 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 635 (N635K)
Ref Sequence ENSEMBL: ENSMUSP00000099316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103027]
Predicted Effect probably benign
Transcript: ENSMUST00000103027
AA Change: N635K

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000099316
Gene: ENSMUSG00000043857
AA Change: N635K

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Glyco_transf_18 184 777 3.5e-269 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126757
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The MGAT5B gene encodes a beta-1,6-N-acetylglucosaminyltransferase (EC 2.4.1.155) that functions in the synthesis of complex cell surface N-glycans (Kaneko et al., 2003 [PubMed 14623122]).[supplied by OMIM, Nov 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit low levels of O-man-linked beta1,6-branched glycans. Mice homozygous for a different knock-out allele exhibit decreased susceptibility to cuprizone induced injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra2c T C 5: 35,280,297 S138P probably damaging Het
Appl1 A C 14: 26,923,854 S666R probably damaging Het
Arhgap45 A G 10: 80,028,750 S879G possibly damaging Het
Calcoco2 T C 11: 96,102,737 M140V probably benign Het
Cap2 C A 13: 46,615,323 H147N probably damaging Het
Chd9 A T 8: 91,041,186 H2437L probably damaging Het
Col5a3 A G 9: 20,771,096 I1684T unknown Het
Comp A T 8: 70,378,957 probably null Het
Cyp2c50 A T 19: 40,091,055 M198L probably benign Het
Dnaaf2 A G 12: 69,196,691 V532A probably benign Het
Dnah10 A T 5: 124,765,562 Q1358L probably benign Het
Dopey2 T A 16: 93,765,516 S832T probably damaging Het
Dus3l T G 17: 56,766,912 F162C possibly damaging Het
Epb41l4a A G 18: 33,921,909 L42P probably damaging Het
Ercc5 T A 1: 44,167,033 S369T probably benign Het
Fam205a1 G T 4: 42,848,424 T1244K probably damaging Het
Fbxl2 C T 9: 113,989,146 V211M probably benign Het
Fermt3 A G 19: 7,018,692 V45A probably damaging Het
Frs3 C A 17: 47,703,222 P280Q possibly damaging Het
Fxn A G 19: 24,262,013 Y172H probably damaging Het
Gabpa T C 16: 84,846,181 V122A probably damaging Het
Gsta4 A G 9: 78,204,288 T66A probably benign Het
Hsdl2 C T 4: 59,612,697 T296M probably damaging Het
Kank4 T C 4: 98,778,896 N438S probably damaging Het
Krt24 A G 11: 99,284,618 I197T probably benign Het
Lct T C 1: 128,287,722 probably null Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mc4r A G 18: 66,859,409 L211P probably damaging Het
Mfsd4b5 T C 10: 39,973,691 T111A probably damaging Het
Mms19 A T 19: 41,952,556 M443K possibly damaging Het
Morc2a G A 11: 3,675,885 V162M probably benign Het
Mroh5 T C 15: 73,787,905 N359S probably benign Het
Mroh9 T C 1: 163,024,592 I843V possibly damaging Het
Nbeal2 T C 9: 110,638,893 D436G probably damaging Het
Nbr1 A G 11: 101,569,766 D502G probably benign Het
Ngfr C T 11: 95,587,545 G5D probably damaging Het
Nlrc4 G A 17: 74,445,906 T494M probably damaging Het
Notch3 T A 17: 32,158,589 H171L probably damaging Het
Nsmaf A G 4: 6,398,880 L795P probably damaging Het
Nup210 T C 6: 91,028,805 T616A possibly damaging Het
Olfr1467 A C 19: 13,364,870 M81L probably benign Het
Olfr347 T A 2: 36,735,192 Y290* probably null Het
Olfr975 C A 9: 39,950,169 V201L possibly damaging Het
Olfr995 T A 2: 85,438,876 Y94F probably benign Het
Osbpl5 T C 7: 143,709,039 H192R probably damaging Het
Parp2 G A 14: 50,820,856 R486Q probably benign Het
Pcgf6 G A 19: 47,040,105 A286V probably damaging Het
Pla2r1 T C 2: 60,428,646 T1133A probably damaging Het
Plekha2 T C 8: 25,072,054 N48S probably damaging Het
Pole T G 5: 110,297,369 S461A probably damaging Het
Ppfibp2 T C 7: 107,729,892 L536P probably damaging Het
Prkcz G T 4: 155,289,751 F69L probably damaging Het
Prkd1 G A 12: 50,394,926 H277Y probably damaging Het
Rab23 A T 1: 33,734,854 K132* probably null Het
Rbck1 T A 2: 152,316,899 S488C probably damaging Het
Rbl1 T C 2: 157,159,734 Y878C probably damaging Het
Rpn2 C T 2: 157,294,155 T161M possibly damaging Het
Rufy4 G A 1: 74,147,678 V542I probably benign Het
Serpinb3d A G 1: 107,080,751 V128A probably benign Het
Smarca2 A G 19: 26,647,034 I365V possibly damaging Het
Sptb A G 12: 76,621,169 V718A probably benign Het
Susd4 A G 1: 182,858,563 H226R probably benign Het
Tmem151b T C 17: 45,545,905 Y203C probably damaging Het
Tmppe T C 9: 114,404,900 V89A possibly damaging Het
Trappc6b A T 12: 59,048,121 probably null Het
Ube4b A T 4: 149,361,294 M433K probably benign Het
Vmn1r202 A T 13: 22,501,370 D292E possibly damaging Het
Vmn1r22 A G 6: 57,900,719 M91T probably benign Het
Vmn1r43 T C 6: 89,869,701 I268V probably benign Het
Vmn1r49 T A 6: 90,072,782 R79S probably benign Het
Vmn2r14 T A 5: 109,219,047 K436* probably null Het
Wdr72 A G 9: 74,210,162 S719G probably damaging Het
Zfp526 T C 7: 25,225,542 F409L probably benign Het
Zfp804b A C 5: 6,771,323 L580R possibly damaging Het
Zfp977 T C 7: 42,580,646 T152A probably benign Het
Zyx T A 6: 42,356,032 V372E possibly damaging Het
Other mutations in Mgat5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Mgat5b APN 11 116931662 missense probably damaging 0.99
IGL01315:Mgat5b APN 11 116923389 missense probably damaging 1.00
IGL01432:Mgat5b APN 11 116973376 missense probably benign
IGL01480:Mgat5b APN 11 116978452 missense probably benign 0.00
IGL02573:Mgat5b APN 11 116977714 missense probably benign 0.01
IGL02627:Mgat5b APN 11 116983616 missense probably damaging 1.00
IGL03053:Mgat5b APN 11 116923450 missense possibly damaging 0.94
R0149:Mgat5b UTSW 11 116985139 splice site probably benign
R1175:Mgat5b UTSW 11 116977796 missense probably damaging 1.00
R1242:Mgat5b UTSW 11 116978404 missense probably benign 0.08
R1341:Mgat5b UTSW 11 116978397 missense probably benign 0.38
R1666:Mgat5b UTSW 11 116983648 missense probably benign 0.01
R1667:Mgat5b UTSW 11 116947377 missense probably benign 0.00
R1702:Mgat5b UTSW 11 116948659 missense possibly damaging 0.73
R1828:Mgat5b UTSW 11 116977788 missense probably damaging 1.00
R2019:Mgat5b UTSW 11 116947348 missense probably benign 0.07
R2102:Mgat5b UTSW 11 116919429 start gained probably benign
R2382:Mgat5b UTSW 11 116919496 missense probably damaging 0.99
R4995:Mgat5b UTSW 11 116974199 critical splice donor site probably null
R5028:Mgat5b UTSW 11 116985029 missense probably damaging 1.00
R5174:Mgat5b UTSW 11 116977715 missense probably benign 0.01
R5403:Mgat5b UTSW 11 116948657 missense probably benign 0.35
R5643:Mgat5b UTSW 11 116973400 missense probably damaging 0.99
R5644:Mgat5b UTSW 11 116973400 missense probably damaging 0.99
R7116:Mgat5b UTSW 11 116944959 missense possibly damaging 0.93
R7238:Mgat5b UTSW 11 116984983 missense probably benign 0.09
R7284:Mgat5b UTSW 11 116944920 missense probably damaging 0.96
R7440:Mgat5b UTSW 11 116968445 nonsense probably null
R7721:Mgat5b UTSW 11 116966801 missense
Predicted Primers PCR Primer
(F):5'- CATCCCTCGGGATTTCCTTGGAAAC -3'
(R):5'- GGCTGCCATTGGTTCTACTAGCTC -3'

Sequencing Primer
(F):5'- CGGGATTTCCTTGGAAACACAAAG -3'
(R):5'- CATGATTGTTGGACCCCAGG -3'
Posted On2014-05-09