Incidental Mutation 'R1668:Cap2'
ID 187398
Institutional Source Beutler Lab
Gene Symbol Cap2
Ensembl Gene ENSMUSG00000021373
Gene Name cyclase associated actin cytoskeleton regulatory protein 2
Synonyms 2810452G09Rik
MMRRC Submission 039704-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R1668 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 46655379-46803757 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 46768799 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 147 (H147N)
Ref Sequence ENSEMBL: ENSMUSP00000153125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021802] [ENSMUST00000119341] [ENSMUST00000225824]
AlphaFold Q9CYT6
Predicted Effect probably damaging
Transcript: ENSMUST00000021802
AA Change: H202N

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000021802
Gene: ENSMUSG00000021373
AA Change: H202N

DomainStartEndE-ValueType
Pfam:CAP_N 5 301 2.6e-117 PFAM
CARP 358 395 1.06e-10 SMART
CARP 396 433 1.12e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119341
SMART Domains Protein: ENSMUSP00000112952
Gene: ENSMUSG00000021373

DomainStartEndE-ValueType
Pfam:CAP_N 4 105 1.8e-25 PFAM
Pfam:CAP_N 99 198 8.2e-29 PFAM
CARP 246 283 1.06e-10 SMART
CARP 284 321 1.12e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225040
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225444
Predicted Effect probably damaging
Transcript: ENSMUST00000225824
AA Change: H147N

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its similarity to the gene for human adenylyl cyclase-associated protein. The function of the protein encoded by this gene is unknown. However, the protein appears to be able to interact with adenylyl cyclase-associated protein and actin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are smaller, prone to eye infections and show microphthalmia, cardiac conduction defects and dilated cardiomyopathy, predominantly in males. Males are underrepresented at weaning and ~70% die suddenly by 12 weeks of age, whereas females survive at nearly expected levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra2c T C 5: 35,437,641 (GRCm39) S138P probably damaging Het
Appl1 A C 14: 26,645,811 (GRCm39) S666R probably damaging Het
Arhgap45 A G 10: 79,864,584 (GRCm39) S879G possibly damaging Het
Calcoco2 T C 11: 95,993,563 (GRCm39) M140V probably benign Het
Chd9 A T 8: 91,767,814 (GRCm39) H2437L probably damaging Het
Col5a3 A G 9: 20,682,392 (GRCm39) I1684T unknown Het
Comp A T 8: 70,831,607 (GRCm39) probably null Het
Cyp2c50 A T 19: 40,079,499 (GRCm39) M198L probably benign Het
Dnaaf2 A G 12: 69,243,465 (GRCm39) V532A probably benign Het
Dnah10 A T 5: 124,842,626 (GRCm39) Q1358L probably benign Het
Dop1b T A 16: 93,562,404 (GRCm39) S832T probably damaging Het
Dus3l T G 17: 57,073,912 (GRCm39) F162C possibly damaging Het
Epb41l4a A G 18: 34,054,962 (GRCm39) L42P probably damaging Het
Ercc5 T A 1: 44,206,193 (GRCm39) S369T probably benign Het
Fbxl2 C T 9: 113,818,214 (GRCm39) V211M probably benign Het
Fermt3 A G 19: 6,996,060 (GRCm39) V45A probably damaging Het
Frs3 C A 17: 48,014,147 (GRCm39) P280Q possibly damaging Het
Fxn A G 19: 24,239,377 (GRCm39) Y172H probably damaging Het
Gabpa T C 16: 84,643,069 (GRCm39) V122A probably damaging Het
Gsta4 A G 9: 78,111,570 (GRCm39) T66A probably benign Het
Hsdl2 C T 4: 59,612,697 (GRCm39) T296M probably damaging Het
Kank4 T C 4: 98,667,133 (GRCm39) N438S probably damaging Het
Krt24 A G 11: 99,175,444 (GRCm39) I197T probably benign Het
Lct T C 1: 128,215,459 (GRCm39) probably null Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,235,260 (GRCm39) probably null Het
Mc4r A G 18: 66,992,480 (GRCm39) L211P probably damaging Het
Mfsd4b5 T C 10: 39,849,687 (GRCm39) T111A probably damaging Het
Mgat5b T A 11: 116,874,474 (GRCm39) N635K probably benign Het
Mms19 A T 19: 41,940,995 (GRCm39) M443K possibly damaging Het
Morc2a G A 11: 3,625,885 (GRCm39) V162M probably benign Het
Mroh5 T C 15: 73,659,754 (GRCm39) N359S probably benign Het
Mroh9 T C 1: 162,852,161 (GRCm39) I843V possibly damaging Het
Nbeal2 T C 9: 110,467,961 (GRCm39) D436G probably damaging Het
Nbr1 A G 11: 101,460,592 (GRCm39) D502G probably benign Het
Ngfr C T 11: 95,478,371 (GRCm39) G5D probably damaging Het
Nlrc4 G A 17: 74,752,901 (GRCm39) T494M probably damaging Het
Notch3 T A 17: 32,377,563 (GRCm39) H171L probably damaging Het
Nsmaf A G 4: 6,398,880 (GRCm39) L795P probably damaging Het
Nup210 T C 6: 91,005,787 (GRCm39) T616A possibly damaging Het
Or10d5 C A 9: 39,861,465 (GRCm39) V201L possibly damaging Het
Or1j18 T A 2: 36,625,204 (GRCm39) Y290* probably null Het
Or5ak25 T A 2: 85,269,220 (GRCm39) Y94F probably benign Het
Or5b113 A C 19: 13,342,234 (GRCm39) M81L probably benign Het
Osbpl5 T C 7: 143,262,776 (GRCm39) H192R probably damaging Het
Parp2 G A 14: 51,058,313 (GRCm39) R486Q probably benign Het
Pcgf6 G A 19: 47,028,544 (GRCm39) A286V probably damaging Het
Pla2r1 T C 2: 60,258,990 (GRCm39) T1133A probably damaging Het
Plekha2 T C 8: 25,562,070 (GRCm39) N48S probably damaging Het
Pole T G 5: 110,445,235 (GRCm39) S461A probably damaging Het
Ppfibp2 T C 7: 107,329,099 (GRCm39) L536P probably damaging Het
Prkcz G T 4: 155,374,208 (GRCm39) F69L probably damaging Het
Prkd1 G A 12: 50,441,709 (GRCm39) H277Y probably damaging Het
Rab23 A T 1: 33,773,935 (GRCm39) K132* probably null Het
Rbck1 T A 2: 152,158,819 (GRCm39) S488C probably damaging Het
Rbl1 T C 2: 157,001,654 (GRCm39) Y878C probably damaging Het
Rpn2 C T 2: 157,136,075 (GRCm39) T161M possibly damaging Het
Rufy4 G A 1: 74,186,837 (GRCm39) V542I probably benign Het
Serpinb3d A G 1: 107,008,481 (GRCm39) V128A probably benign Het
Smarca2 A G 19: 26,624,434 (GRCm39) I365V possibly damaging Het
Spata31f1a G T 4: 42,848,424 (GRCm39) T1244K probably damaging Het
Sptb A G 12: 76,667,943 (GRCm39) V718A probably benign Het
Susd4 A G 1: 182,686,128 (GRCm39) H226R probably benign Het
Tmem151b T C 17: 45,856,831 (GRCm39) Y203C probably damaging Het
Tmppe T C 9: 114,233,968 (GRCm39) V89A possibly damaging Het
Trappc6b A T 12: 59,094,907 (GRCm39) probably null Het
Ube4b A T 4: 149,445,751 (GRCm39) M433K probably benign Het
Vmn1r202 A T 13: 22,685,540 (GRCm39) D292E possibly damaging Het
Vmn1r22 A G 6: 57,877,704 (GRCm39) M91T probably benign Het
Vmn1r43 T C 6: 89,846,683 (GRCm39) I268V probably benign Het
Vmn1r49 T A 6: 90,049,764 (GRCm39) R79S probably benign Het
Vmn2r14 T A 5: 109,366,913 (GRCm39) K436* probably null Het
Wdr72 A G 9: 74,117,444 (GRCm39) S719G probably damaging Het
Zfp526 T C 7: 24,924,967 (GRCm39) F409L probably benign Het
Zfp804b A C 5: 6,821,323 (GRCm39) L580R possibly damaging Het
Zfp977 T C 7: 42,230,070 (GRCm39) T152A probably benign Het
Zyx T A 6: 42,332,966 (GRCm39) V372E possibly damaging Het
Other mutations in Cap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01810:Cap2 APN 13 46,793,425 (GRCm39) splice site probably benign
IGL01927:Cap2 APN 13 46,789,109 (GRCm39) missense probably benign 0.03
IGL02213:Cap2 APN 13 46,789,087 (GRCm39) splice site probably benign
IGL02511:Cap2 APN 13 46,684,498 (GRCm39) start codon destroyed probably null 0.12
IGL02871:Cap2 APN 13 46,678,968 (GRCm39) missense probably benign 0.00
R0063:Cap2 UTSW 13 46,791,508 (GRCm39) splice site probably benign
R0063:Cap2 UTSW 13 46,791,508 (GRCm39) splice site probably benign
R0234:Cap2 UTSW 13 46,791,498 (GRCm39) critical splice donor site probably null
R0234:Cap2 UTSW 13 46,791,498 (GRCm39) critical splice donor site probably null
R0385:Cap2 UTSW 13 46,714,023 (GRCm39) missense probably damaging 1.00
R0387:Cap2 UTSW 13 46,713,992 (GRCm39) missense probably damaging 0.99
R0712:Cap2 UTSW 13 46,768,837 (GRCm39) splice site probably null
R1489:Cap2 UTSW 13 46,763,111 (GRCm39) missense probably damaging 1.00
R1666:Cap2 UTSW 13 46,768,799 (GRCm39) missense probably damaging 0.98
R1676:Cap2 UTSW 13 46,791,335 (GRCm39) missense probably damaging 1.00
R1756:Cap2 UTSW 13 46,684,489 (GRCm39) missense probably benign 0.11
R1822:Cap2 UTSW 13 46,768,823 (GRCm39) missense probably benign 0.03
R1867:Cap2 UTSW 13 46,793,555 (GRCm39) missense probably damaging 1.00
R1972:Cap2 UTSW 13 46,791,375 (GRCm39) missense probably damaging 0.98
R1990:Cap2 UTSW 13 46,791,357 (GRCm39) missense possibly damaging 0.93
R1991:Cap2 UTSW 13 46,791,357 (GRCm39) missense possibly damaging 0.93
R1992:Cap2 UTSW 13 46,791,357 (GRCm39) missense possibly damaging 0.93
R2144:Cap2 UTSW 13 46,713,978 (GRCm39) critical splice acceptor site probably null
R3039:Cap2 UTSW 13 46,793,317 (GRCm39) missense probably benign 0.20
R4024:Cap2 UTSW 13 46,791,317 (GRCm39) splice site probably benign
R4554:Cap2 UTSW 13 46,789,250 (GRCm39) missense probably damaging 1.00
R4748:Cap2 UTSW 13 46,793,302 (GRCm39) missense possibly damaging 0.64
R4821:Cap2 UTSW 13 46,763,586 (GRCm39) missense probably damaging 0.99
R4876:Cap2 UTSW 13 46,684,497 (GRCm39) start codon destroyed probably null
R4902:Cap2 UTSW 13 46,684,501 (GRCm39) missense probably damaging 0.99
R5320:Cap2 UTSW 13 46,801,840 (GRCm39) makesense probably null
R5666:Cap2 UTSW 13 46,684,559 (GRCm39) splice site probably null
R5670:Cap2 UTSW 13 46,684,559 (GRCm39) splice site probably null
R6086:Cap2 UTSW 13 46,789,188 (GRCm39) missense probably damaging 1.00
R6728:Cap2 UTSW 13 46,793,335 (GRCm39) missense possibly damaging 0.87
R6842:Cap2 UTSW 13 46,800,101 (GRCm39) missense probably damaging 1.00
R7785:Cap2 UTSW 13 46,789,224 (GRCm39) missense probably benign
R7889:Cap2 UTSW 13 46,800,051 (GRCm39) missense probably damaging 0.99
R8065:Cap2 UTSW 13 46,791,337 (GRCm39) missense probably damaging 1.00
R8205:Cap2 UTSW 13 46,768,739 (GRCm39) missense probably damaging 1.00
R8425:Cap2 UTSW 13 46,763,208 (GRCm39) missense probably damaging 0.98
R8731:Cap2 UTSW 13 46,800,006 (GRCm39) missense probably benign 0.00
R8738:Cap2 UTSW 13 46,684,548 (GRCm39) missense probably benign 0.00
R9320:Cap2 UTSW 13 46,768,818 (GRCm39) missense probably benign 0.04
R9491:Cap2 UTSW 13 46,791,366 (GRCm39) missense possibly damaging 0.92
R9686:Cap2 UTSW 13 46,678,926 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACTAGGTATGGCACACTCCCTC -3'
(R):5'- GGCGGTCAACAGAGTCTCCTAAAG -3'

Sequencing Primer
(F):5'- AGGGTTACCCACATTCTCAGTG -3'
(R):5'- TCCTAAAGGAAAGGCTGTTTCCAC -3'
Posted On 2014-05-09