Incidental Mutation 'R1668:Fermt3'
ID187414
Institutional Source Beutler Lab
Gene Symbol Fermt3
Ensembl Gene ENSMUSG00000024965
Gene Namefermitin family member 3
SynonymsKindlin-3, C79673
MMRRC Submission 039704-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1668 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location6998958-7019469 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7018692 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 45 (V45A)
Ref Sequence ENSEMBL: ENSMUSP00000037858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025918] [ENSMUST00000040772]
Predicted Effect probably benign
Transcript: ENSMUST00000025918
SMART Domains Protein: ENSMUSP00000025918
Gene: ENSMUSG00000024966

DomainStartEndE-ValueType
TPR 4 37 3.07e-5 SMART
TPR 38 71 1.63e0 SMART
TPR 72 105 5.87e-2 SMART
STI1 130 169 4.84e-1 SMART
low complexity region 192 220 N/A INTRINSIC
TPR 225 258 7.45e-4 SMART
TPR 259 292 1.1e-1 SMART
TPR 300 333 1.09e-5 SMART
TPR 360 393 1.07e-4 SMART
TPR 394 427 9.45e-6 SMART
TPR 428 461 3.29e-5 SMART
STI1 492 531 1.66e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000040772
AA Change: V45A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037858
Gene: ENSMUSG00000024965
AA Change: V45A

DomainStartEndE-ValueType
Blast:B41 14 77 6e-32 BLAST
B41 94 556 1.66e-28 SMART
PH 350 455 2.26e-12 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Kindlins are a small family of proteins that mediate protein-protein interactions involved in integrin activation and thereby have a role in cell adhesion, migration, differentiation, and proliferation. The protein encoded by this gene has a key role in the regulation of hemostasis and thrombosis. This protein may also help maintain the membrane skeleton of erythrocytes. Mutations in this gene cause the autosomal recessive leukocyte adhesion deficiency syndrome-III (LAD-III). Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jan 2010]
PHENOTYPE: Disruption of this marker results in lethality in the first week after birth, abnormal erythropoiesis and platelet function, and severe hemorrhage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra2c T C 5: 35,280,297 S138P probably damaging Het
Appl1 A C 14: 26,923,854 S666R probably damaging Het
Arhgap45 A G 10: 80,028,750 S879G possibly damaging Het
Calcoco2 T C 11: 96,102,737 M140V probably benign Het
Cap2 C A 13: 46,615,323 H147N probably damaging Het
Chd9 A T 8: 91,041,186 H2437L probably damaging Het
Col5a3 A G 9: 20,771,096 I1684T unknown Het
Comp A T 8: 70,378,957 probably null Het
Cyp2c50 A T 19: 40,091,055 M198L probably benign Het
Dnaaf2 A G 12: 69,196,691 V532A probably benign Het
Dnah10 A T 5: 124,765,562 Q1358L probably benign Het
Dopey2 T A 16: 93,765,516 S832T probably damaging Het
Dus3l T G 17: 56,766,912 F162C possibly damaging Het
Epb41l4a A G 18: 33,921,909 L42P probably damaging Het
Ercc5 T A 1: 44,167,033 S369T probably benign Het
Fam205a1 G T 4: 42,848,424 T1244K probably damaging Het
Fbxl2 C T 9: 113,989,146 V211M probably benign Het
Frs3 C A 17: 47,703,222 P280Q possibly damaging Het
Fxn A G 19: 24,262,013 Y172H probably damaging Het
Gabpa T C 16: 84,846,181 V122A probably damaging Het
Gsta4 A G 9: 78,204,288 T66A probably benign Het
Hsdl2 C T 4: 59,612,697 T296M probably damaging Het
Kank4 T C 4: 98,778,896 N438S probably damaging Het
Krt24 A G 11: 99,284,618 I197T probably benign Het
Lct T C 1: 128,287,722 probably null Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mc4r A G 18: 66,859,409 L211P probably damaging Het
Mfsd4b5 T C 10: 39,973,691 T111A probably damaging Het
Mgat5b T A 11: 116,983,648 N635K probably benign Het
Mms19 A T 19: 41,952,556 M443K possibly damaging Het
Morc2a G A 11: 3,675,885 V162M probably benign Het
Mroh5 T C 15: 73,787,905 N359S probably benign Het
Mroh9 T C 1: 163,024,592 I843V possibly damaging Het
Nbeal2 T C 9: 110,638,893 D436G probably damaging Het
Nbr1 A G 11: 101,569,766 D502G probably benign Het
Ngfr C T 11: 95,587,545 G5D probably damaging Het
Nlrc4 G A 17: 74,445,906 T494M probably damaging Het
Notch3 T A 17: 32,158,589 H171L probably damaging Het
Nsmaf A G 4: 6,398,880 L795P probably damaging Het
Nup210 T C 6: 91,028,805 T616A possibly damaging Het
Olfr1467 A C 19: 13,364,870 M81L probably benign Het
Olfr347 T A 2: 36,735,192 Y290* probably null Het
Olfr975 C A 9: 39,950,169 V201L possibly damaging Het
Olfr995 T A 2: 85,438,876 Y94F probably benign Het
Osbpl5 T C 7: 143,709,039 H192R probably damaging Het
Parp2 G A 14: 50,820,856 R486Q probably benign Het
Pcgf6 G A 19: 47,040,105 A286V probably damaging Het
Pla2r1 T C 2: 60,428,646 T1133A probably damaging Het
Plekha2 T C 8: 25,072,054 N48S probably damaging Het
Pole T G 5: 110,297,369 S461A probably damaging Het
Ppfibp2 T C 7: 107,729,892 L536P probably damaging Het
Prkcz G T 4: 155,289,751 F69L probably damaging Het
Prkd1 G A 12: 50,394,926 H277Y probably damaging Het
Rab23 A T 1: 33,734,854 K132* probably null Het
Rbck1 T A 2: 152,316,899 S488C probably damaging Het
Rbl1 T C 2: 157,159,734 Y878C probably damaging Het
Rpn2 C T 2: 157,294,155 T161M possibly damaging Het
Rufy4 G A 1: 74,147,678 V542I probably benign Het
Serpinb3d A G 1: 107,080,751 V128A probably benign Het
Smarca2 A G 19: 26,647,034 I365V possibly damaging Het
Sptb A G 12: 76,621,169 V718A probably benign Het
Susd4 A G 1: 182,858,563 H226R probably benign Het
Tmem151b T C 17: 45,545,905 Y203C probably damaging Het
Tmppe T C 9: 114,404,900 V89A possibly damaging Het
Trappc6b A T 12: 59,048,121 probably null Het
Ube4b A T 4: 149,361,294 M433K probably benign Het
Vmn1r202 A T 13: 22,501,370 D292E possibly damaging Het
Vmn1r22 A G 6: 57,900,719 M91T probably benign Het
Vmn1r43 T C 6: 89,869,701 I268V probably benign Het
Vmn1r49 T A 6: 90,072,782 R79S probably benign Het
Vmn2r14 T A 5: 109,219,047 K436* probably null Het
Wdr72 A G 9: 74,210,162 S719G probably damaging Het
Zfp526 T C 7: 25,225,542 F409L probably benign Het
Zfp804b A C 5: 6,771,323 L580R possibly damaging Het
Zfp977 T C 7: 42,580,646 T152A probably benign Het
Zyx T A 6: 42,356,032 V372E possibly damaging Het
Other mutations in Fermt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Fermt3 APN 19 7003258 unclassified probably null
IGL01724:Fermt3 APN 19 7001775 missense probably damaging 0.99
IGL01748:Fermt3 APN 19 7003466 critical splice donor site probably null
IGL02392:Fermt3 APN 19 7018815 missense probably benign 0.35
IGL02956:Fermt3 APN 19 7002344 missense probably benign 0.40
IGL03146:Fermt3 APN 19 7003263 missense possibly damaging 0.88
IGL03216:Fermt3 APN 19 6999380 missense probably benign 0.00
P0026:Fermt3 UTSW 19 7014424 missense probably damaging 0.99
R0180:Fermt3 UTSW 19 7002343 missense possibly damaging 0.76
R0445:Fermt3 UTSW 19 7003299 missense probably benign 0.29
R1202:Fermt3 UTSW 19 7003482 missense probably damaging 1.00
R1475:Fermt3 UTSW 19 7018874 intron probably null
R2179:Fermt3 UTSW 19 7014414 missense probably benign 0.14
R2311:Fermt3 UTSW 19 7014162 missense probably damaging 0.97
R3976:Fermt3 UTSW 19 7002424 missense possibly damaging 0.74
R4087:Fermt3 UTSW 19 7003577 critical splice acceptor site probably null
R4667:Fermt3 UTSW 19 7002920 missense probably damaging 1.00
R6108:Fermt3 UTSW 19 7014414 missense probably benign 0.14
R6452:Fermt3 UTSW 19 7014737 missense probably benign 0.00
R6994:Fermt3 UTSW 19 6999727 missense probably damaging 1.00
R7334:Fermt3 UTSW 19 7003038 missense probably benign 0.03
R7357:Fermt3 UTSW 19 7002843 missense probably benign
Z1177:Fermt3 UTSW 19 7014679 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- AATAAGCCTCGGCACAGGCAAG -3'
(R):5'- ACAGTAGCTCTCTGTACCAGTGTCC -3'

Sequencing Primer
(F):5'- TGTCTCTTGGAGACTAGACAGAAC -3'
(R):5'- TCTGTACCAGTGTCCCCAAAG -3'
Posted On2014-05-09