Incidental Mutation 'R1669:Arhgef4'
ID187421
Institutional Source Beutler Lab
Gene Symbol Arhgef4
Ensembl Gene ENSMUSG00000037509
Gene NameRho guanine nucleotide exchange factor (GEF) 4
Synonyms9330140K16Rik, Asef
MMRRC Submission 039705-MU
Accession Numbers

Genbank: NM_183019; MGI: 2442507; Ensembl: ENSMUSG00000070955

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1669 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location34678188-34813309 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34732158 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 1182 (H1182L)
Ref Sequence ENSEMBL: ENSMUSP00000124213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159747] [ENSMUST00000162599]
Predicted Effect possibly damaging
Transcript: ENSMUST00000159747
AA Change: H1182L

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124213
Gene: ENSMUSG00000037509
AA Change: H1182L

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
low complexity region 686 712 N/A INTRINSIC
low complexity region 915 926 N/A INTRINSIC
low complexity region 1119 1137 N/A INTRINSIC
low complexity region 1240 1254 N/A INTRINSIC
SH3 1361 1416 3.73e-16 SMART
RhoGEF 1453 1632 3.86e-56 SMART
PH 1665 1773 2.33e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162599
AA Change: H15L

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000124906
Gene: ENSMUSG00000037509
AA Change: H15L

DomainStartEndE-ValueType
low complexity region 73 87 N/A INTRINSIC
SH3 194 249 3.73e-16 SMART
Pfam:RhoGEF 304 405 1.2e-25 PFAM
PH 438 546 2.33e-14 SMART
Meta Mutation Damage Score 0.0682 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 99% (85/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The protein encoded by this gene may form complex with G proteins and stimulate Rho-dependent signals. Multiple alternatively spliced transcript variants encoding different isoforms have been found, but the full-length nature of some variants has not been determined. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased angiogenesis, vascular endothelial cell migration, tumor growth, and tumor vascularization. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano10 A C 9: 122,257,183 L258R possibly damaging Het
Ap3d1 A G 10: 80,710,836 probably benign Het
Aplp2 G T 9: 31,167,733 probably benign Het
Arhgap11a T C 2: 113,841,912 D237G possibly damaging Het
Ash1l G A 3: 89,067,242 probably null Het
Bicdl1 C A 5: 115,656,016 V224L possibly damaging Het
Cacna1h C A 17: 25,383,471 V1422L probably damaging Het
Card10 T C 15: 78,793,953 E365G probably benign Het
Cd180 C T 13: 102,705,490 T348I probably damaging Het
Cds2 T A 2: 132,295,519 probably null Het
Chaf1a C A 17: 56,063,339 D601E probably benign Het
Coprs C T 8: 13,885,704 W12* probably null Het
Cpsf3 T A 12: 21,305,331 M424K probably damaging Het
Cxcl13 T A 5: 95,958,741 N57K probably damaging Het
Dact1 C T 12: 71,318,773 T776M probably damaging Het
Depdc1a A G 3: 159,522,924 K438E probably benign Het
Dopey2 T A 16: 93,769,660 S992T probably damaging Het
Dusp11 A T 6: 85,950,026 H202Q probably benign Het
Ezr T C 17: 6,739,313 E584G probably damaging Het
F830104G03Rik A G 3: 56,890,577 V6A unknown Het
Fam227a G A 15: 79,620,677 probably null Het
Gapvd1 T G 2: 34,730,682 probably null Het
Gm10267 T C 18: 44,157,300 R47G probably damaging Het
Gm13088 T G 4: 143,654,346 E369A possibly damaging Het
Gm6614 T A 6: 141,987,689 I457F probably benign Het
Hectd3 T A 4: 116,999,643 D462E probably damaging Het
Hfe A T 13: 23,706,127 L133* probably null Het
Hpcal4 T C 4: 123,189,076 F72L probably damaging Het
Itgb4 G A 11: 115,991,330 R825H probably benign Het
Kcnh8 T A 17: 52,893,968 Y477N probably damaging Het
Kctd1 T C 18: 15,062,460 N369D possibly damaging Het
Kdm1b C T 13: 47,068,548 R488C probably damaging Het
Kif1c C T 11: 70,728,397 L953F probably damaging Het
Klra8 A T 6: 130,115,629 C236* probably null Het
Lca5l T C 16: 96,159,808 R485G possibly damaging Het
Lrrc2 A G 9: 110,981,650 T363A probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Lyst G A 13: 13,644,087 G1314D possibly damaging Het
Mmp10 A T 9: 7,505,525 probably null Het
Mmp13 A G 9: 7,277,926 D273G probably benign Het
Morc2a G A 11: 3,675,885 V162M probably benign Het
Msh4 C T 3: 153,876,720 R417Q possibly damaging Het
Nedd9 A T 13: 41,311,794 V790E probably damaging Het
Nlgn1 C A 3: 25,436,134 L476F probably damaging Het
Nox4 C A 7: 87,295,889 Q118K probably benign Het
Nxf1 A G 19: 8,772,131 T131A possibly damaging Het
Olfr1261 T A 2: 89,993,800 probably null Het
Olfr13 T A 6: 43,174,821 S278R probably damaging Het
Olfr1361 A T 13: 21,659,286 S12R possibly damaging Het
Olfr1447 A T 19: 12,901,288 I164K possibly damaging Het
Olfr518 T A 7: 108,880,713 T298S probably benign Het
Olfr643 A T 7: 104,059,309 S98T probably benign Het
Oog3 C A 4: 144,158,438 R309S probably benign Het
Oosp3 C T 19: 11,701,014 probably benign Het
P2ry6 A G 7: 100,938,423 V243A probably damaging Het
Pgc C A 17: 47,733,790 P321T probably damaging Het
Prkd1 G A 12: 50,394,926 H277Y probably damaging Het
Prkdc T A 16: 15,734,058 S2043T probably damaging Het
Rasal3 T C 17: 32,403,098 N96D possibly damaging Het
Rnf4 T C 5: 34,351,280 F162S probably damaging Het
Ros1 A T 10: 52,161,811 N421K probably damaging Het
Rtn4rl1 A G 11: 75,265,927 D395G probably benign Het
Scn8a T G 15: 101,011,120 V823G probably damaging Het
Sema3d T A 5: 12,508,084 probably benign Het
Slc12a2 T C 18: 57,904,235 I501T probably damaging Het
Slc12a7 C T 13: 73,795,113 T382I probably benign Het
Slc16a12 T A 19: 34,680,381 I41L probably benign Het
Slc1a1 C A 19: 28,911,794 T489K probably benign Het
Slc24a3 C T 2: 145,613,592 P467L probably damaging Het
Snai2 A T 16: 14,707,044 Y138F possibly damaging Het
Sorcs1 A C 19: 50,475,422 Y197D probably damaging Het
Sppl2a T A 2: 126,917,794 probably benign Het
Srgap3 G A 6: 112,722,904 P1038S probably benign Het
Ttn T C 2: 76,724,463 E30699G probably damaging Het
Vmn2r124 T A 17: 18,062,944 M300K possibly damaging Het
Vwf T C 6: 125,647,906 S1873P possibly damaging Het
Wrap73 A G 4: 154,156,131 D360G probably damaging Het
Zfp366 T C 13: 99,229,561 M410T probably damaging Het
Zfp608 C T 18: 54,987,739 V259I probably benign Het
Zfp69 C T 4: 120,947,498 probably benign Het
Zfp995 T C 17: 21,879,964 T430A probably benign Het
Other mutations in Arhgef4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Arhgef4 APN 1 34811696 missense possibly damaging 0.88
IGL02376:Arhgef4 APN 1 34806059 missense probably damaging 1.00
IGL02604:Arhgef4 APN 1 34811723 nonsense probably null
IGL03240:Arhgef4 APN 1 34806026 missense probably benign 0.03
R0095:Arhgef4 UTSW 1 34732370 nonsense probably null
R0157:Arhgef4 UTSW 1 34806394 missense probably damaging 1.00
R0243:Arhgef4 UTSW 1 34806999 intron probably null
R0383:Arhgef4 UTSW 1 34810533 missense probably damaging 1.00
R0440:Arhgef4 UTSW 1 34745448 splice site probably null
R0452:Arhgef4 UTSW 1 34732322 missense probably damaging 0.97
R0893:Arhgef4 UTSW 1 34807110 missense probably damaging 1.00
R1429:Arhgef4 UTSW 1 34810339 missense probably damaging 1.00
R1437:Arhgef4 UTSW 1 34723945 missense unknown
R1780:Arhgef4 UTSW 1 34724160 missense possibly damaging 0.73
R1809:Arhgef4 UTSW 1 34810555 critical splice donor site probably null
R1879:Arhgef4 UTSW 1 34722440 missense unknown
R1908:Arhgef4 UTSW 1 34724259 missense probably benign 0.01
R1919:Arhgef4 UTSW 1 34811140 missense probably damaging 0.98
R2020:Arhgef4 UTSW 1 34723810 missense unknown
R2058:Arhgef4 UTSW 1 34722377 missense unknown
R2213:Arhgef4 UTSW 1 34807149 unclassified probably null
R2851:Arhgef4 UTSW 1 34724048 missense unknown
R2852:Arhgef4 UTSW 1 34724048 missense unknown
R2853:Arhgef4 UTSW 1 34724048 missense unknown
R3697:Arhgef4 UTSW 1 34722440 missense unknown
R4012:Arhgef4 UTSW 1 34725106 missense possibly damaging 0.75
R4118:Arhgef4 UTSW 1 34732347 missense probably damaging 0.98
R4133:Arhgef4 UTSW 1 34806104 missense probably damaging 1.00
R4534:Arhgef4 UTSW 1 34723081 missense unknown
R4535:Arhgef4 UTSW 1 34723081 missense unknown
R4581:Arhgef4 UTSW 1 34732124 missense possibly damaging 0.83
R4665:Arhgef4 UTSW 1 34806032 missense possibly damaging 0.89
R4678:Arhgef4 UTSW 1 34722668 missense unknown
R4684:Arhgef4 UTSW 1 34811785 unclassified probably null
R4706:Arhgef4 UTSW 1 34732217 missense probably benign 0.00
R4745:Arhgef4 UTSW 1 34807275 missense probably damaging 1.00
R4747:Arhgef4 UTSW 1 34723274 missense unknown
R4988:Arhgef4 UTSW 1 34723454 missense unknown
R5063:Arhgef4 UTSW 1 34724215 missense probably benign 0.00
R5154:Arhgef4 UTSW 1 34732374 missense probably benign 0.43
R5156:Arhgef4 UTSW 1 34723274 missense unknown
R5263:Arhgef4 UTSW 1 34724997 missense possibly damaging 0.84
R5450:Arhgef4 UTSW 1 34807324 intron probably benign
R5807:Arhgef4 UTSW 1 34807615 intron probably benign
R5863:Arhgef4 UTSW 1 34722845 missense unknown
R6034:Arhgef4 UTSW 1 34721903 missense unknown
R6034:Arhgef4 UTSW 1 34721903 missense unknown
R6311:Arhgef4 UTSW 1 34723981 missense unknown
R6315:Arhgef4 UTSW 1 34723477 missense unknown
R6316:Arhgef4 UTSW 1 34723477 missense unknown
R6318:Arhgef4 UTSW 1 34723477 missense unknown
R6323:Arhgef4 UTSW 1 34723477 missense unknown
R6324:Arhgef4 UTSW 1 34723477 missense unknown
R6325:Arhgef4 UTSW 1 34723477 missense unknown
R6340:Arhgef4 UTSW 1 34732223 missense probably damaging 1.00
R6835:Arhgef4 UTSW 1 34806493 missense probably damaging 1.00
R6981:Arhgef4 UTSW 1 34722452 missense unknown
R7087:Arhgef4 UTSW 1 34811686 missense probably damaging 0.96
R7297:Arhgef4 UTSW 1 34807192 missense probably damaging 1.00
R7525:Arhgef4 UTSW 1 34809704 missense probably damaging 1.00
R7614:Arhgef4 UTSW 1 34732235 missense possibly damaging 0.67
R7693:Arhgef4 UTSW 1 34724141 missense probably benign 0.01
RF012:Arhgef4 UTSW 1 34724484 small deletion probably benign
X0062:Arhgef4 UTSW 1 34724227 missense probably benign 0.35
YA93:Arhgef4 UTSW 1 34732217 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCGGCCCTTGACCAAATCAGAAG -3'
(R):5'- TGTCATCGAAGCTGAAGTGTGAGTG -3'

Sequencing Primer
(F):5'- CGAAATGGCTGTGAATGAAGTATCTC -3'
(R):5'- AAGCTGAAGTGTGAGTGTTGAG -3'
Posted On2014-05-09